IPT, DQ792508.1-IPT.m1 (mRNA) Malus hupehensis

Transcript Overview
Unique NameDQ792508.1-IPT.m1
OrganismMalus hupehensis ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
IPTIPTMalus hupehensisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
DQ792508.1-IPT.m1-cds1DQ792508.1-IPT.m1-cds1Malus hupehensisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
IPTDQ792508.1-IPT.p1Malus hupehensispolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
DQ792508 region DQ792508:201..1163+ NCBI Rosaceae gene and mRNA sequences
Chr03 chromosome Chr03:35283549..35284511+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr3 chromosome chr3:31482982..31483944- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr3 chromosome chr3:37001355..37002317+ Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
Genbank noteMhIPT
The following sequences are available for this feature:

mRNA sequence

>DQ792508.1-IPT.m1 ID=DQ792508.1-IPT.m1|Name=IPT|organism=Malus hupehensis|type=mRNA|length=963bp
back to top

protein sequence of IPT

>DQ792508.1-IPT.p1 ID=DQ792508.1-IPT.p1|Name=IPT|organism=Malus hupehensis|type=polypeptide|length=320bp
back to top

mRNA from alignment at DQ792508:201..1163+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ792508.1-IPT.m1 ID=DQ792508.1-IPT.m1|Name=IPT|organism=Malus hupehensis|type=mRNA|length=963bp|location=Sequence derived from alignment at DQ792508:201..1163+ (Malus hupehensis)
atgatgccaatgtgcaaacaaatacaaacattactacatgttccatctag tggccataatcataaaatggacgtgttcaatcctcaccggcagaaggaga aggtggtgatcgtaatgggagcaacagggaccggaaagtcaaggctctcc atcgacctagccacctgtttcccggcagaaatcataaactccgacaaaat gcaagtctacgaaggccttgacatagtcaccaacaaaataaccaaagaag agcaacgtggtgtaccgcaccatttgctagggatgctagatcctcatgaa gattttactgccagggatttttgtgacctaacctcaattgccattgaatc cattttaggccgtgatcggcttccaatcatcgttggaggttccaactctt acatcgaggcgttgatcgatgattatgactataaatttcggtccaagtat gactgttgctttttatgggtagatgtgtctacacccgctctgcactcttt tgtgtcaaaacgggtagaccacatggttcaaaacggaatggtggatgagg cgagagagtactttgatcccaatgcagattacacgaaagggattcgaaga gcaataggggtccctgaattcgataagtacttcaggtatgggccattttt ggaagaagaaactcgtgctcggttactacgacaagcagtggacgaaatta aggacaatacgtgcaaattggcatgtcggcaactggagaagattcataga cttagaaatatcaaagggtggaatctgcacccgttggatgccacggaggt gttccgaaagcgcggcgaagaggccgacgaggcctggaaaaagcttgtgt cggggacaagtgctatgatcgttggccagtttctttacaatatgacagct gaggttcctccacatcttggaagccttagggttcttgaagcacttgcagc tgcaactcactag
back to top

Coding sequence (CDS) from alignment at DQ792508:201..1163+

>DQ792508.1-IPT.m1 ID=DQ792508.1-IPT.m1|Name=IPT|organism=Malus hupehensis|type=CDS|length=963bp|location=Sequence derived from alignment at DQ792508:201..1163+ (Malus hupehensis)
back to top