ANR, DQ099803.1-ANR.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameDQ099803.1-ANR.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ANRANRMalus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
DQ099803.1-ANR.m1-cds1DQ099803.1-ANR.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ANRDQ099803.1-ANR.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
DQ099803 region DQ099803:84..1103+ NCBI Rosaceae gene and mRNA sequences
Chr10 chromosome Chr10:39619220..39622385- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
unanchored chromosome unanchored:2247782..2250563+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
unanchored chromosome unanchored:2240427..2243592- Malus x domestica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Productanthocyanidin reductase
The following sequences are available for this feature:

mRNA sequence

>DQ099803.1-ANR.m1 ID=DQ099803.1-ANR.m1|Name=ANR|organism=Malus x domestica|type=mRNA|length=1020bp
back to top

protein sequence of ANR

>DQ099803.1-ANR.p1 ID=DQ099803.1-ANR.p1|Name=ANR|organism=Malus x domestica|type=polypeptide|length=339bp
back to top

mRNA from alignment at DQ099803:84..1103+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ099803.1-ANR.m1 ID=DQ099803.1-ANR.m1|Name=ANR|organism=Malus x domestica|type=mRNA|length=1020bp|location=Sequence derived from alignment at DQ099803:84..1103+ (Malus x domestica)
atggccacccaacaacccatctcaaagaagacggcttgcgtcgtcggcgg aaccgggttcgtggcgtctctgctggtcaagctactgctccagaagggct acgccgtcagaaccaccgtcagagaccctgacaaccacaagaaggtctcc cacctcacagcactacaagagttgggtgagctagagattttggcaggaga tctaactgatgaagggagcttcgatgccccaatagcaggctgtgatcttg ttttccatgttgcaacccctgtcaactttgcctcacaggacccggagaat gatatgatcaaaccagcaatccaaggggtactaaatgttctgaagtcgtg cgtgaaagccaaaacagttaagcgcgttgttttgacatcatcagctgcta cagtttcgatcaatacacttgaaggaacaggtttggtcgtggatgaaaag gattggagtgatttggagttcttgactaatgtaaagccacccacttgggg gtaccctgcctccaagacactagctgagaagacagcttggaaatttgccg aagaaaacaacattgatctaatcactgtgatcccttctcttatggccggt ccttctctcactccagacgttcccagcagtatcggccttgccatggcttt aatcacaggagatgatttcctcataaatatggccctgaaaggtatgcaaa tgttatcaggttcgatatccattgcacatgtggaggacgtctgccgggct catatatttttggctgagaaagaatctgcatctggtcggtacatttgctg tgctgccaacaccggcgttcctgagcttgctaagttcctcaacaaaagat acccccagtacaaagtccccactgagtttggagattttccgtctgaggcc aaactgatcatctcttcagagaagcttatcaaggaggggttcgattttaa gtatggcatcgaagaaatatatgaccaaactgtggagtacttcaaggcaa aggggctgctgcagaagtag
back to top

Coding sequence (CDS) from alignment at DQ099803:84..1103+

>DQ099803.1-ANR.m1 ID=DQ099803.1-ANR.m1|Name=ANR|organism=Malus x domestica|type=CDS|length=1020bp|location=Sequence derived from alignment at DQ099803:84..1103+ (Malus x domestica)
back to top