S4-RNase, AF432418.1-S4-RNase.m1 (mRNA) Prunus salicina

Transcript Overview
Unique NameAF432418.1-S4-RNase.m1
OrganismPrunus salicina ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
S4-RNaseAF432418.1-S4-RNasePrunus salicinagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
S4-RNaseS4-RNasePrunus salicinagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AF432418.1-S4-RNase.m1-cds1AF432418.1-S4-RNase.m1-cds1Prunus salicinaCDS
AF432418.1-S4-RNase.m1-cds2AF432418.1-S4-RNase.m1-cds2Prunus salicinaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
S4-RNaseAF432418.1-S4-RNase.p1Prunus salicinapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AF432418 region AF432418:1..1283+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>AF432418.1-S4-RNase.m1 ID=AF432418.1-S4-RNase.m1|Name=S4-RNase|organism=Prunus salicina|type=mRNA|length=284bp
back to top

protein sequence of S4-RNase

>AF432418.1-S4-RNase.p1 ID=AF432418.1-S4-RNase.p1|Name=S4-RNase|organism=Prunus salicina|type=polypeptide|length=95bp
back to top

mRNA from alignment at AF432418:1..1283+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF432418.1-S4-RNase.m1 ID=AF432418.1-S4-RNase.m1|Name=S4-RNase|organism=Prunus salicina|type=mRNA|length=1283bp|location=Sequence derived from alignment at AF432418:1..1283+ (Prunus salicina)
ctatggccaagtaattattcaaacccaaagattcccagtaattgcaaggg ggcgctatttggggcaaggaaagtggtatgtacgcatttagtttttagaa aaattagattgtcacatgaagacaatatactttgttgataaaccttgggt gttagataaatcctgatgttgctcttctgcttgggaacattattttagat atatacacctaagcacacatttatatttgtagctatattaatgtacctac ctacctacctatacatttataaaagagtactcctattttcatccacccac cttatcttcaaaattttaaagagaaatttacccatttgtaaaatgacttc taaaaggacttggggaaaaaagcctcaactcacgtaacccacctattcta ccgtttgacaaaaagaagaagaagaagaagaaagcgcaatagaaaattac cttcaaatgtataaatttctctttaaaacatttatccataatattttcaa aaactacaaggcatataattaaaaaactaaaagatcctgaaaatcaaaat attggactaaaacatttattgagtccatcaaacacaacttgatcctctcc atatctcaattactaatgattagcaaagaaaaatagcttgaattaataat taaagggtattttaggaataatggtgggtggaaggataagattgtatttt ttcaaatttacatggtgagtgggaaaataggacatggggtggaaataaca gcactcttataaaaatataagcgatgtcaacggagtctagcatagtgaaa aatgacattaacttgcaaacaacatgtctcgggttcgaccccgatagcat cttcattttttgtgtgtgtgaaaaatcaccatctcctgtagtttagacta tcttttgtactccaaaaaatgtaaatgatcatctaattaaagcacctatc atatcgtgcttacgtatatatttaactattgtacatctaaatcaaaattc agtacaatactcaggtttaatatagaaaacaatctaattgaagaatggat gtatgtgttgcttggatgtctcagtaccctcagttgcaattgaacctgaa gatatcttggccggacgtaaaaagtggcaacgagacaaatttttggcaaa gcgaatggaacaagcatggcacatgttctgaacggacactcaaccaaatg caatacttcgagcgatcagacgaaatgtggaactcgtacaatattacaga gatccttaaaaacgcttcaatcgtaccacatcc
back to top

Coding sequence (CDS) from alignment at AF432418:1..1283+

>AF432418.1-S4-RNase.m1 ID=AF432418.1-S4-RNase.m1|Name=S4-RNase|organism=Prunus salicina|type=CDS|length=284bp|location=Sequence derived from alignment at AF432418:1..1283+ (Prunus salicina)
back to top