LFY, FJ532000.1-LFY.m1 (mRNA) Fragaria vesca

Transcript Overview
Unique NameFJ532000.1-LFY.m1
OrganismFragaria vesca (Woodland strawberry (diploid))
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYFragaria vescagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
FJ532000.1-LFY.m1-cds1FJ532000.1-LFY.m1-cds1Fragaria vescaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYFJ532000.1-LFY.p1Fragaria vescapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
FJ532000 region FJ532000:1..477+ NCBI Rosaceae gene and mRNA sequences
LG3 chromosome LG3:3080568..3081172+ Fragaria vesca Whole Genome v1.0 (build 8) Assembly & Annotation
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>FJ532000.1-LFY.m1 ID=FJ532000.1-LFY.m1|Name=LFY|organism=Fragaria vesca|type=mRNA|length=477bp
back to top

protein sequence of LFY

>FJ532000.1-LFY.p1 ID=FJ532000.1-LFY.p1|Name=LFY|organism=Fragaria vesca|type=polypeptide|length=158bp
back to top

mRNA from alignment at FJ532000:1..477+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>FJ532000.1-LFY.m1 ID=FJ532000.1-LFY.m1|Name=LFY|organism=Fragaria vesca|type=mRNA|length=477bp|location=Sequence derived from alignment at FJ532000:1..477+ (Fragaria vesca)
gtacgtggcaaaagtaatggactggattacctcttccatctctacaaaga gtgccatcagtttttgacccaggtccagaagattgccaagaagcgtggtg aaaaatgtcccaccaagatgacaaacaaggtgtttaggtatgcgaaagaa gaaggagccaaccacatcaacaagcccaaaatgcggcattacgttcactg ctacgcgctgcattgcctggacgaggagcgatcaaatgcgttgaggcgag agtgcaagctgcgaggagacaacatcggggcgtggatgcaggcgtgttac aggtctgtggtggaaatagctgcaccccgaggctgggacattgatgccat tttcagtgaacatcctcagctatctgtttggtacgttcctaccaaacttc gccagctttgtcatgccgagcgcaacaatgccaccgcgtctagctccgcc tcaggtggaaaggatactgctgcatga
back to top

Coding sequence (CDS) from alignment at FJ532000:1..477+

>FJ532000.1-LFY.m1 ID=FJ532000.1-LFY.m1|Name=LFY|organism=Fragaria vesca|type=CDS|length=477bp|location=Sequence derived from alignment at FJ532000:1..477+ (Fragaria vesca)
back to top