Xth2, DQ320658.2-Xth2.m1 (mRNA) Rosa x borboniana

Transcript Overview
Unique NameDQ320658.2-Xth2.m1
OrganismRosa x borboniana ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
Xth2Xth2Rosa x borbonianagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
DQ320658.2-Xth2.m1-cds1DQ320658.2-Xth2.m1-cds1Rosa x borbonianaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
Xth2DQ320658.2-Xth2.p1Rosa x borbonianapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
DQ320658 region DQ320658:90..953+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productxyloglucan endotransglucosylase/hydrolase 2
The following sequences are available for this feature:

mRNA sequence

>DQ320658.2-Xth2.m1 ID=DQ320658.2-Xth2.m1|Name=Xth2|organism=Rosa x borboniana|type=mRNA|length=864bp
back to top

protein sequence of Xth2

>DQ320658.2-Xth2.p1 ID=DQ320658.2-Xth2.p1|Name=Xth2|organism=Rosa x borboniana|type=polypeptide|length=287bp
back to top

mRNA from alignment at DQ320658:90..953+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ320658.2-Xth2.m1 ID=DQ320658.2-Xth2.m1|Name=Xth2|organism=Rosa x borboniana|type=mRNA|length=864bp|location=Sequence derived from alignment at DQ320658:90..953+ (Rosa x borboniana)
atgaggagtagtgttactgcttctatttccctttgtttcctttcactatt ttccctctcagcctttgcacgaccagccacttttcttcaggatttccaag tcacatggtctgattctcatatcaggcaaatcgatggagggagggccatc caactcgttcttgaccaaaactctggttgtggcttttcctccaaacacaa gtacttgtttggccgtgtgagcatgaagatcaagctcattcccggtgact ctgccggaactgtcaccgctttctatatgaactcggacacagatacagta cgtgatgagcttgattttgagttcttggggaacaggactggacagcctta cacagtccagaccaatatctatgctcgtggacagggtaacagggagcaaa gggtgaacctctggtttgaccctgctgcagatttccacacttacacaatt ctctggaaccatcaccatattgtcttctatgtagatgatgtgcctatcag gctgtacaagaacaatgaagcgaaaggaatcccatacccaaagctccaac ccatgggggtgttctcaacattgtgggaagctgatgattgggcaacaaga ggagggcttgagaagataaactggagcaaagcccccttctatgcttatta caaggactttgacatcgaaggatgctctgtgccaggaccagctaattgtg cctcaagcactaataactggtgggaaggcactgcttaccaagcactcaat gcccttgaatatagaagatacaagtgggttcgtatgaaccacatgatcta cgattactgctccgacagatcccggttcccaaaacccccacccgagtgtg tcgccggcctctaa
back to top

Coding sequence (CDS) from alignment at DQ320658:90..953+

>DQ320658.2-Xth2.m1 ID=DQ320658.2-Xth2.m1|Name=Xth2|organism=Rosa x borboniana|type=CDS|length=864bp|location=Sequence derived from alignment at DQ320658:90..953+ (Rosa x borboniana)
back to top