ACO, AB499127.1-ACO.m1 (mRNA) Prunus mume

Transcript Overview
Unique NameAB499127.1-ACO.m1
OrganismPrunus mume ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ACOACOPrunus mumegene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AB499127.1-ACO.m1-cds1AB499127.1-ACO.m1-cds1Prunus mumeCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ACOAB499127.1-ACO.p1Prunus mumepolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AB499127 region AB499127:6..920+ NCBI Rosaceae gene and mRNA sequences
scaffold_3 supercontig scaffold_3:16205673..16206881- Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Product1-aminocyclopropane-1-carboxylate oxidase
The following sequences are available for this feature:

mRNA sequence

>AB499127.1-ACO.m1 ID=AB499127.1-ACO.m1|Name=ACO|organism=Prunus mume|type=mRNA|length=915bp
back to top

protein sequence of ACO

>AB499127.1-ACO.p1 ID=AB499127.1-ACO.p1|Name=ACO|organism=Prunus mume|type=polypeptide|length=305bp
back to top

mRNA from alignment at AB499127:6..920+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB499127.1-ACO.m1 ID=AB499127.1-ACO.m1|Name=ACO|organism=Prunus mume|type=mRNA|length=915bp|location=Sequence derived from alignment at AB499127:6..920+ (Prunus mume)
atggagaacttcccaatcatcaacttggagggcctcaatggagagggaag gaaagcaacaatggaaaaaatcaaagatgcctgtgagaactggggcttct ttgagcttgtgagtcatgggataccaactgagtttttggacacagtggag aggttgactaaagaacactacaggcagtgcttggagcagaggttcaagga gctggtggccagcaagggccttgaggctgtcaagacagaggtcaatgata tggactgggaaagcaccttctacttgcgccatcttccaaaatctaacata tctgaagttccagatcttgaggatcagtacaggaatgtgatgaaggaatt tgcattgaagttggagaaattagcagagcagctcctagacttgctctgtg agaatcttggacttgaacaagggtacctcaagaaggccttctatggaaca aatggaccaacttttggcaccaaggttagcaactaccctccttgtcccaa ccctgagctgatcaagggtctccgggctcacaccgatgccggcggcctca tcctgctcttccaggatgacaaggtcagtggtctgcagctcctcaaggat ggccaatggattgatgtgcctcccatgcgccactccattgttatcaacct tggtgaccaacttgaggtgatcactaacgggaagtacaagagcgtggagc acagagtgattgcccaaactgatggcaccagaatgtcaatagcttccttc tacaaccctggcagtgatgctgtcatctaccctgcaccaacactggtgga gaaagaagcagaggagaagaatcaagtgtaccccgaaattcgtgttcgaa gactacatgaagctctatgctggcctcaagttccagcccaaagagccgcg attcgaggcgatgaa
back to top

Coding sequence (CDS) from alignment at AB499127:6..920+

>AB499127.1-ACO.m1 ID=AB499127.1-ACO.m1|Name=ACO|organism=Prunus mume|type=CDS|length=915bp|location=Sequence derived from alignment at AB499127:6..920+ (Prunus mume)
back to top