F3H, EU255776.1-F3H.m1 (mRNA) Rubus coreanus

Transcript Overview
Unique NameEU255776.1-F3H.m1
OrganismRubus coreanus ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
F3HF3HRubus coreanusgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU255776.1-F3H.m1-cds1EU255776.1-F3H.m1-cds1Rubus coreanusCDS
EU255776.1-F3H.m1-cds2EU255776.1-F3H.m1-cds2Rubus coreanusCDS
EU255776.1-F3H.m1-cds3EU255776.1-F3H.m1-cds3Rubus coreanusCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
F3HEU255776.1-F3H.p1Rubus coreanuspolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU255776 region EU255776:1..1612+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>EU255776.1-F3H.m1 ID=EU255776.1-F3H.m1|Name=F3H|organism=Rubus coreanus|type=mRNA|length=1098bp
back to top

protein sequence of F3H

>EU255776.1-F3H.p1 ID=EU255776.1-F3H.p1|Name=F3H|organism=Rubus coreanus|type=polypeptide|length=365bp
back to top

mRNA from alignment at EU255776:1..1612+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU255776.1-F3H.m1 ID=EU255776.1-F3H.m1|Name=F3H|organism=Rubus coreanus|type=mRNA|length=1612bp|location=Sequence derived from alignment at EU255776:1..1612+ (Rubus coreanus)
atggctcctacacctactactctgaccgccatagcgggggagaagactct tcaacagagcttcgtccgcgacgaagacgagcgccccaaggtggcctaca accaattcagcaacgaaatcccgatcatttcgctctccggcatcgacgag gtcgaaggccgccgtgcagagatttgcaacaagattgtcgaggcctgtga ggactggggcgttttccagattgttgatcatggcgtcgacgccaagctca tatccgaaatgactcgtctcgctagagacttcttcgctttgccaccggag gaaaagctccggtttgacatgtccggtggcaaaaagggcggcttcattgt ctccagccatttacaggtgaatcaatagatcggaaactcgcggtctccga tatcatgatgttaaagttcataaaaaaaatgtgatatttttaattttaag ctgttagaacaattattttacatatattgtgacatatgtgtgtgtcacgg cagggagaggcggtgcaagattggcgcgagattgtgacctacttctcata cccggttcgccaccgggactactcgaggtggcccgacaagccggaagggt ggagggcggtgactcagcagtacagtgacgagctgatgggtttggcatgc aagctgttggaggttttatcagaagccatgggtttagagaaggaggcatt gacaaaggcatgtgtggacatggaccaaaaagttgtggtcaatttctacc cgaaatgcccccaacccgacctcactctcggactcaagcgccacacggat ccgggtaccattacccttttgcttcaagaccaggttggtggtctccaagc caccagagatggtggaaagacgtggatcaccgttcaacctgtggaaggag cttttgtggtcaaccttggagatcatggacatgtgagtatagggtggatt tagaacaattttaattatctttaataaattaatctaattaataattatac tgtcacaatctttatgtgattttgaataagcaagatagggacatattaat tgttatttatgtcaaactccatatggtccaagtgcattccatattactca gataagtaaatactatttgtcttcaagtgatagtggaaactaaaatcatg ggtccatttaattgatttatgagtttctaagcaattgaaggttcaataga cattatttggtaaatttgtattaatgaataattattagtatttatatccc ttgatatgaatatacatatatgtatgtatgtattaacgcattatttggtg aacaaacagtttttgagcaacgggagattcaagaacgccgatcaccaagc agtggtgaactcgaaccacagcaggctgtccatagccacattccagaacc ctgcacaggaggccatagtatacccactcaaggtgagggagggagagaag cccattttggaggagccaatcacctacactgagatgtacaagaagaagat gagcaaggaccttgagcttgccaggctgaagaagcttgccaaggaacagc aacctgaggactcagagaaggccaaacttgaggtcaagcaagtggatgat atttttgcttga
back to top

Coding sequence (CDS) from alignment at EU255776:1..1612+

>EU255776.1-F3H.m1 ID=EU255776.1-F3H.m1|Name=F3H|organism=Rubus coreanus|type=CDS|length=1098bp|location=Sequence derived from alignment at EU255776:1..1612+ (Rubus coreanus)
back to top