C4H, EU123531.1-C4H.m1 (mRNA) Rubus coreanus

Transcript Overview
Unique NameEU123531.1-C4H.m1
OrganismRubus coreanus ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
C4HC4HRubus coreanusgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU123531.1-C4H.m1-cds1EU123531.1-C4H.m1-cds1Rubus coreanusCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
C4HEU123531.1-C4H.p1Rubus coreanuspolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU123531 region EU123531:51..1565+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Genbank noteRcoC4H
The following sequences are available for this feature:

mRNA sequence

>EU123531.1-C4H.m1 ID=EU123531.1-C4H.m1|Name=C4H|organism=Rubus coreanus|type=mRNA|length=1515bp
back to top

protein sequence of C4H

>EU123531.1-C4H.p1 ID=EU123531.1-C4H.p1|Name=C4H|organism=Rubus coreanus|type=polypeptide|length=504bp
back to top

mRNA from alignment at EU123531:51..1565+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU123531.1-C4H.m1 ID=EU123531.1-C4H.m1|Name=C4H|organism=Rubus coreanus|type=mRNA|length=1515bp|location=Sequence derived from alignment at EU123531:51..1565+ (Rubus coreanus)
atggatctcctcctcatggagaagaccctcttggggctcttcgcagccgt cgtcgtcgccataaccgtatccaagctccgcggcaagaaattcaagctcc ccccgggtccgatacccgtccccgttttcggcaactggctccaggtcggc gacgacctgaaccaccgcaatctgaccgacatggccaagaaattcggcga ggtgttcatgctccgcatggggcagcgcaacctcgtcgtcgtgtcatcgc cggacctcgccaaggaggtcctccacacgcagggagtcgagttcgggtca aggacccgaaacgtggtcttcgacatcttcaccggaaaaggacaggacat ggtgttcaccgtctacggcgagcactggcgcaaaatgcggcggatcatga cggtcccgttcttcacgaacaaggtggtccagcagtaccgttacggatgg gaatcggaggccgcggcggtggtggaggacgtgaaaaagcacccggaggc ggcgaccaatgggatggtgctacgtaggcggctgcagcttatgatgtaca acaacatgtacaggatcatgttcgatagaaggttcgagagcgaggacgac ccgttgttcgtgaaattgaagggtttgaacggagagaggagccgattggc gcagagcttcgagtacaactacggcgatttcattccggtgctcagaccct tcttgaggggttacttgaacatctgtaaggaagtgaaggagaagaggatt cagctgttcaaggactatttcgttgatgagagaaagaaactttcaagcac acaagccacaactaacgaagggttgaagtgtgccattgaccacatcttgg acgctcagcagaaaggagagatcaacgaggacaacgtcctttacatcgtc gagaacattaacgttgccgcaattgaaaccgcactatggtcaatcgagtg gggaattgccgagcttgtgaaccaccctgaaatccaaaagaagttgaggg atgagctcgacactgttcttggccatggtgttcaagtcacggagcccgaa attcaaaaactgccgtacctccaagctgtggtcaaagagactctaaggct tcgcatggcaatccctctcctcgtcccacacatgaatcttcacgacgcaa agctcggtggctttgacattccagctgagagcaagatcttggtcaatgct tggtggcttgcaaacaaccctgcacactggaagaagcctgaggagttcag gcccgagaggtttttggaagaagagtccaaagttgaggccaatggtaatg acttcaggtaccttccatttggtgttgggaggaggagttgtcccgggatt attttagcactgccgattctcgggattactttgggacgtttggtccagaa ctttgagctcttgcctcctccaggacagactcagcttgacacgacagaga aaggtggacaatttagtctgcacatcttgaagcattccaccatagtcatg aagccaaggacataa
back to top

Coding sequence (CDS) from alignment at EU123531:51..1565+

>EU123531.1-C4H.m1 ID=EU123531.1-C4H.m1|Name=C4H|organism=Rubus coreanus|type=CDS|length=1515bp|location=Sequence derived from alignment at EU123531:51..1565+ (Rubus coreanus)
back to top