DREB1, EU854320.1-DREB1.m1 (mRNA) Prunus canescens x Prunus cerasus

Transcript Overview
Unique NameEU854320.1-DREB1.m1
OrganismPrunus canescens x Prunus cerasus ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
DREB1DREB1Prunus canescens x Prunus cerasusgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU854320.1-DREB1.m1-cds1EU854320.1-DREB1.m1-cds1Prunus canescens x Prunus cerasusCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
DREB1EU854320.1-DREB1.p1Prunus canescens x Prunus cerasuspolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU854320 region EU854320:1..723+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productdehydration-responsive element-binding factor 1/C-repeat binding factor
Genbank noteDREB1/CBF
The following sequences are available for this feature:

mRNA sequence

>EU854320.1-DREB1.m1 ID=EU854320.1-DREB1.m1|Name=DREB1|organism=Prunus canescens x Prunus cerasus|type=mRNA|length=723bp
back to top

protein sequence of DREB1

>EU854320.1-DREB1.p1 ID=EU854320.1-DREB1.p1|Name=DREB1|organism=Prunus canescens x Prunus cerasus|type=polypeptide|length=240bp
back to top

mRNA from alignment at EU854320:1..723+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU854320.1-DREB1.m1 ID=EU854320.1-DREB1.m1|Name=DREB1|organism=Prunus canescens x Prunus cerasus|type=mRNA|length=723bp|location=Sequence derived from alignment at EU854320:1..723+ (Prunus canescens x Prunus cerasus)
atggacatgttcttctctcaactttccgactcggtcgaccagcccgagtc gagttctttgtccgacgccagcatcaccactcggggggcttcttgttcca acggggacgtcatattggcttcgagtcggccgaagaagcgagccgggagg agggttttcaaggagacgaggcaccccgtttataggggtgtgaggaggag gaacaatgataagtgggtgtgtgaaatgagagagcccaacaacaagaagt ccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcc catgacgtggcggcattggcgtttagagggaagcttgcctgcctcaactt tgctgattccacgtggaggctgcccttgccggcttcaatggataccatgg atattcgaagggcggccgcggaggcagctgaggggtttaggccggcggag tttggtggagtgtgcagcggcagcagtgatgagaaggagagaatggtggt gcaggtggaagagaagaacaagaagggtagtgtgaacttggaaagaagca gaagcttgagcttgtcctattgggatgaggacgaagtgtttgacatgccc aggttgcttcatgacatggctgaagggcttcttctttctccatcgcaatg cttaggtggctacatgaatttggatgacatgggcaccgatgctgatgtca aattgtggagtttctccatttaa
back to top

Coding sequence (CDS) from alignment at EU854320:1..723+

>EU854320.1-DREB1.m1 ID=EU854320.1-DREB1.m1|Name=DREB1|organism=Prunus canescens x Prunus cerasus|type=CDS|length=723bp|location=Sequence derived from alignment at EU854320:1..723+ (Prunus canescens x Prunus cerasus)
back to top