SFB17, EU652885.1-SFB17.m1 (mRNA) Prunus armeniaca

Transcript Overview
Unique NameEU652885.1-SFB17.m1
OrganismPrunus armeniaca (Apricot)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
SFB17EU652885.1-SFB17Prunus armeniacagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
SFB17SFB17Prunus armeniacagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU652885.1-SFB17.m1-cds1EU652885.1-SFB17.m1-cds1Prunus armeniacaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
SFB17EU652885.1-SFB17.p1Prunus armeniacapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU652885 region EU652885:1..1131+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductS-locus F-box protein 17
The following sequences are available for this feature:

mRNA sequence

>EU652885.1-SFB17.m1 ID=EU652885.1-SFB17.m1|Name=SFB17|organism=Prunus armeniaca|type=mRNA|length=1131bp
back to top

protein sequence of SFB17

>EU652885.1-SFB17.p1 ID=EU652885.1-SFB17.p1|Name=SFB17|organism=Prunus armeniaca|type=polypeptide|length=376bp
back to top

mRNA from alignment at EU652885:1..1131+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU652885.1-SFB17.m1 ID=EU652885.1-SFB17.m1|Name=SFB17|organism=Prunus armeniaca|type=mRNA|length=1131bp|location=Sequence derived from alignment at EU652885:1..1131+ (Prunus armeniaca)
atggcatcgacactacgtaagaaagaaatcttagtcgacatcctactaag actacctgcaaaatccctcgttcggtttctttgtacatgcaagttatgga gtaatttgatttgcagcttgagtttcgctagcacacaccttcacaggaat gtcacaggacatgcccatgcctatctactttgcctccaccagccaaattt tgaatgtcaaagggacgatgatgacccatattttaaagaagaactccaat ggtcattgttttccaatgtaacatttgagcagtgctgcacgttaagccat ccattagggagcacagaacattatgggatatatggttcaagcaatggttt agtttgcatttcggatgagatattgaattttgatagtcctatacacatat ggaacccatcggttaggaaacttaggacccctccaatgagcaccaacact aacattaaatttagctatgttgctcttcaattcgggtttcactccggagt taatgactacaaggttgttaggatgatgcgtaccaacaaaaatgccttgg cggttgaggtttatagtcttggtacagactgctggaagctgattcaagca attcctccttggttaaaatgcacttggaagcatcacaagggtacattttt gaatggagtagcataccacatcattgagaaaggtcctatattcagcatta tgtccttcgattcaggcagtgaagacttcgaagaattcatagcaccagat gccatttgcaattcatggaagttatgcatccaagtttacaaggaacagat ttgcttgctttttggattttatggttgtgaggaggagggcatggaaaaca ttgacatatgggttctgcaagaaaaacggtggaaacaattgtatcctttt atttatgatcctttggattgctgttatcagataatcgggactagtataaa caatgaactcttaatggcaagaagagatttcgatgacggggtagtaggtc tgcaattgggtaattacgaatccaagcaagttcttgacacagggattaag ttggccatcatgagatatggggaaatcgaattcttgtttgcaattactta catagaaagtttagttttactcaataactaa
back to top

Coding sequence (CDS) from alignment at EU652885:1..1131+

>EU652885.1-SFB17.m1 ID=EU652885.1-SFB17.m1|Name=SFB17|organism=Prunus armeniaca|type=CDS|length=1131bp|location=Sequence derived from alignment at EU652885:1..1131+ (Prunus armeniaca)
back to top