SFBB18-gamma, EU081896.1-SFBB18-gamma.m1 (mRNA) Pyrus x bretschneideri

Transcript Overview
Unique NameEU081896.1-SFBB18-gamma.m1
OrganismPyrus x bretschneideri ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
SFBB18-gammaSFBB18-gammaPyrus x bretschneiderigene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU081896.1-SFBB18-gamma.m1-cds1EU081896.1-SFBB18-gamma.m1-cds1Pyrus x bretschneideriCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
SFBB18-gammaEU081896.1-SFBB18-gamma.p1Pyrus x bretschneideripolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU081896 region EU081896:37..1227+ NCBI Rosaceae gene and mRNA sequences
scaffold01086 supercontig scaffold01086:55113..56303+ Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>EU081896.1-SFBB18-gamma.m1 ID=EU081896.1-SFBB18-gamma.m1|Name=SFBB18-gamma|organism=Pyrus x bretschneideri|type=mRNA|length=1191bp
back to top

protein sequence of SFBB18-gamma

>EU081896.1-SFBB18-gamma.p1 ID=EU081896.1-SFBB18-gamma.p1|Name=SFBB18-gamma|organism=Pyrus x bretschneideri|type=polypeptide|length=396bp
back to top

mRNA from alignment at EU081896:37..1227+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU081896.1-SFBB18-gamma.m1 ID=EU081896.1-SFBB18-gamma.m1|Name=SFBB18-gamma|organism=Pyrus x bretschneideri|type=mRNA|length=1191bp|location=Sequence derived from alignment at EU081896:37..1227+ (Pyrus x bretschneideri)
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaat cttgtccaggttgccacccaagtctctgatgcgattcaaatgcatacgca aatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctc agcgattctgtggacaacaaactctcatcctccacttgtatccttctcaa ctgttctcaggctcacgtttgctcggaaaagagttggaaacaagaagttt catggtccgtgattaatctttccattgatggtgatgagcttcattatgat attgaggacctaactattgtaccgtttctaaaggatggccctcatgaagt agagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgat tcatgccttcttctaccccttcccggggtaaaagaaaaattcggattgga aacgacacttaaaggactgggatttggttatgattgcaaagctaaagaat acaaggttgtgcgaattatagataattatgatcgtgagtattcagaagat ggagaaacatatatcgagcatattgctcttccttacactgctgaagtata caccatggctgctaactcttggaaagagatcacgattgatatactaagta aaatattatcatcatatagcgaaccatattcttattcagtgtatttgaag gggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt tgatttagctaatgaaatatctgatatgatagaattgccttttaggggag aattcggttttaaacgtgatggtatttttctgtacaatgaatccctcact tattattgcagtagttatgaagagccttccacattatttgagatatgggt aatggactacgatgatggatttaagagttcatggacaaaacacctaactg ctggaccttttacagatatggagtttccattgacaccttggaaacgtgac gagcttcttatgattgcctccgatggaagagctgcctcttataattcttg taccggaaatttcaagtatcttcatattcctgttattattaatcagaata gggttgtagattacgtgaaaagtattattctagtcaattga
back to top

Coding sequence (CDS) from alignment at EU081896:37..1227+

>EU081896.1-SFBB18-gamma.m1 ID=EU081896.1-SFBB18-gamma.m1|Name=SFBB18-gamma|organism=Pyrus x bretschneideri|type=CDS|length=1191bp|location=Sequence derived from alignment at EU081896:37..1227+ (Pyrus x bretschneideri)
back to top