PAL1, AB360390.1-PAL1.m1 (mRNA) Fragaria x ananassa

Transcript Overview
Unique NameAB360390.1-PAL1.m1
OrganismFragaria x ananassa (Strawberry)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
PAL1PAL1Fragaria x ananassagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AB360390.1-PAL1.m1-cds1AB360390.1-PAL1.m1-cds1Fragaria x ananassaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
PAL1AB360390.1-PAL1.p1Fragaria x ananassapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AB360390 region AB360390:1..563+ NCBI Rosaceae gene and mRNA sequences
LG6 chromosome LG6:8936539..8937101+ Fragaria vesca Whole Genome v1.0 (build 8) Assembly & Annotation
Property NameValue
Productphenylalanine ammonia-lyase
The following sequences are available for this feature:

mRNA sequence

>AB360390.1-PAL1.m1 ID=AB360390.1-PAL1.m1|Name=PAL1|organism=Fragaria x ananassa|type=mRNA|length=563bp
back to top

protein sequence of PAL1

>AB360390.1-PAL1.p1 ID=AB360390.1-PAL1.p1|Name=PAL1|organism=Fragaria x ananassa|type=polypeptide|length=188bp
back to top

mRNA from alignment at AB360390:1..563+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB360390.1-PAL1.m1 ID=AB360390.1-PAL1.m1|Name=PAL1|organism=Fragaria x ananassa|type=mRNA|length=563bp|location=Sequence derived from alignment at AB360390:1..563+ (Fragaria x ananassa)
agtgctgagcagcacaaccaggatgtcaactctttggggctgatttcgtc acgaaaaactgcagaagcagttgacatactgaagctcatgtcttccacat ttttggtagcgctttgccaagccattgatttgaggcatttggaggagaac ttgaagagcacggttaagaacactgtgagtcagttggccaagaggctttt aactaccggggtgaatggagagcttcacccttcgaggttctgtgagaagg atttgcttatggttgtcgaaagggagtaccttttcgcctacattgacgat ccttgcagcgctacatatccgttgatgcaaaggctaaggcaagtgcttgt tgaacacgccttgacaaatggtgaaaatgagaagaacgcaaacacttcaa ttttccaaaagatttcggcatttgaggaagagcttaagaccattttgcct aaagaggttgagagcgttagggctgcatgcgagagcggtaatgcggcgat tccaaacagaatcatcgagtgcaggtcatatcctttgtacaaatttgtga gggaggagttggg
back to top

Coding sequence (CDS) from alignment at AB360390:1..563+

>AB360390.1-PAL1.m1 ID=AB360390.1-PAL1.m1|Name=PAL1|organism=Fragaria x ananassa|type=CDS|length=563bp|location=Sequence derived from alignment at AB360390:1..563+ (Fragaria x ananassa)
back to top