Si-RNase, DQ058402.1-Si-RNase.m1 (mRNA) Prunus dulcis

Transcript Overview
Unique NameDQ058402.1-Si-RNase.m1
OrganismPrunus dulcis (Almond)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
Si-RNaseSi-RNasePrunus dulcisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
DQ058402.1-Si-RNase.m1-cds1DQ058402.1-Si-RNase.m1-cds1Prunus dulcisCDS
DQ058402.1-Si-RNase.m1-cds2DQ058402.1-Si-RNase.m1-cds2Prunus dulcisCDS
DQ058402.1-Si-RNase.m1-cds3DQ058402.1-Si-RNase.m1-cds3Prunus dulcisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
Si-RNaseDQ058402.1-Si-RNase.p1Prunus dulcispolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
DQ058402 region DQ058402:1..1616+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>DQ058402.1-Si-RNase.m1 ID=DQ058402.1-Si-RNase.m1|Name=Si-RNase|organism=Prunus dulcis|type=mRNA|length=596bp
back to top

protein sequence of Si-RNase

>DQ058402.1-Si-RNase.p1 ID=DQ058402.1-Si-RNase.p1|Name=Si-RNase|organism=Prunus dulcis|type=polypeptide|length=198bp
back to top

mRNA from alignment at DQ058402:1..1616+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ058402.1-Si-RNase.m1 ID=DQ058402.1-Si-RNase.m1|Name=Si-RNase|organism=Prunus dulcis|type=mRNA|length=1616bp|location=Sequence derived from alignment at DQ058402:1..1616+ (Prunus dulcis)
cgggcgatgttgaaatcgtcactcggtttccttgttcttgcttttgcttt cttcatgtgtttcattatgtgcactggatctggtgggttgcatcttttcc tctttatattctatatgcagataattaattagcattgcatttttttactt ctattttatgtttagagaaatattgcgtgtgttcgatgatatatatcagg taagggaggacttggtctagcacactttggatgagtaactatttgggaat tatttttctgcatggtttcttatcgtttactctgatagttgctgcaacaa gtggtattcatcattgggagctaaaattatgctctttatacatcaaaacc ttatttaagataccattaaccttctcacaataattttgcaggatcttatg tctattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgc atcaagcgaccttgctccaaacctcggccactacaaaatttcaccatcca tggcctttggccaagtaattattcaaacccaacgaagcccagtaattgca atggggcaaaatatgaggacaggaaagtggtcattatttttttattttct ctttagtttttagaaaattaaattgtcatgtgaagataatatactttcaa tgaatctttgggtgtcctaaaatttcgatgtcggtccttgttagacacat tattttgaataaataactaccacgtagatattacttttattgaaccacgt agatattatgatatcctccaattgaaggacctgctattattctgcatgta tatattcaaaatactataccaaaatcaaatcagaaaatgataaataaaaa aagtcattcacacaagacaaaatgttraagtggtaaattggacaaatcgg tccagtcattgtccgacaatgacatgaaataactcttatgtcactgtcgg acagtgaccccagagttgttcaaagtcactctcagtgagtgacttaagag tttatttcatgtcactgtcttacaaggattggaccgttttgtccaatttt tgaaggactagaccattttgtctcgatgccctcctatttgtacttatatg ataaagcccgggccccaaattaaaattcaatttaataatcagggttaacg aagagaaaaacaaatttatcaaataatgaaatctatctatccttttttac ccctaaaaaaaattttaaaaaatctaactatcccttwaggttttgctttt tctgaaaatatgtctacattgtttgcatgtcagccctaaattgcgatcca aactcaagagatcttggcccgacgtggaaagtggcaatgatacaagattt tgggaaggcgaatggaacaaacatggcagatgttccgaacagacacttaa ccaaatgcaatacttcgaggtatcccatgacatgtggctgtcgtacaata ttactgagatcctaagaaacgcttcaatcgtaccacatccgacacaaaca tggacctactcggacatagtatcacccattaaagcagcaactaaacgaac acccctcattcgttgcaaaattgatacagcaactaatactgagttgttac atgaagtggtattttg
back to top

Coding sequence (CDS) from alignment at DQ058402:1..1616+

>DQ058402.1-Si-RNase.m1 ID=DQ058402.1-Si-RNase.m1|Name=Si-RNase|organism=Prunus dulcis|type=CDS|length=596bp|location=Sequence derived from alignment at DQ058402:1..1616+ (Prunus dulcis)
back to top