ACO, EF451060.1-ACO.m1 (mRNA) Pyrus pyrifolia

Transcript Overview
Unique NameEF451060.1-ACO.m1
OrganismPyrus pyrifolia ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ACOACOPyrus pyrifoliagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EF451060.1-ACO.m1-cds1EF451060.1-ACO.m1-cds1Pyrus pyrifoliaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ACOEF451060.1-ACO.p1Pyrus pyrifoliapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EF451060 region EF451060:64..1008+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductACC oxidase
The following sequences are available for this feature:

mRNA sequence

>EF451060.1-ACO.m1 ID=EF451060.1-ACO.m1|Name=ACO|organism=Pyrus pyrifolia|type=mRNA|length=945bp
back to top

protein sequence of ACO

>EF451060.1-ACO.p1 ID=EF451060.1-ACO.p1|Name=ACO|organism=Pyrus pyrifolia|type=polypeptide|length=314bp
back to top

mRNA from alignment at EF451060:64..1008+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF451060.1-ACO.m1 ID=EF451060.1-ACO.m1|Name=ACO|organism=Pyrus pyrifolia|type=mRNA|length=945bp|location=Sequence derived from alignment at EF451060:64..1008+ (Pyrus pyrifolia)
atggcgaccttcccagttgttgacttgagccttgtcaatggtgaagagag agtagcaaccttggagaagatcaatgatgcttgtgagaactggggtttct ttgagttggtgaaccatgggatatctactgagcttttggacactgtggag aagatgaccaaggatcactacaagaagaccatggagcaaaggtttaagga aatggtggcagccaaaggcctcgacgctgtccagtccgaaatccacgact tggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatt tccgaagtccctgatctcgaggaagattacaggaagaccatgaaagaatt tgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtg agaatcttggactcgagaagggttatctgaagaaggttttctatggatcc aagggtccgaattttgggaccaaggtcagcaactaccctccatgccccaa gccagacctgatcaagggactccgggcccacagcgacgccggtggcatca tcctgcttttccaggatgacaaggtcagcggcctccagcttctcaaggat ggtgaatgggtggatgtccccccaatgcaccactccattgtcataaactt aggtgaccagattgaggtgatcaccaatgggaagtacaagagtgtgatgc accgggtgatagctcagtcggacgggaccagaatgtcgatagcctcgttc tacaacccaggcgatgatgcctttatcagcccagcaccggcagtgcttga gaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgact acatgaagctgtattctggcctgaaattccaagccaaggaaccaagattt gaagctatgaaggccaaggaatcgacccctgttgcaactacctga
back to top

Coding sequence (CDS) from alignment at EF451060:64..1008+

>EF451060.1-ACO.m1 ID=EF451060.1-ACO.m1|Name=ACO|organism=Pyrus pyrifolia|type=CDS|length=945bp|location=Sequence derived from alignment at EF451060:64..1008+ (Pyrus pyrifolia)
back to top