BRP41, AM268395.1-BRP41.m1 (mRNA) Rosa hybrid cultivar

Transcript Overview
Unique NameAM268395.1-BRP41.m1
OrganismRosa hybrid cultivar ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP41AM268395.1-BRP41Rosa hybrid cultivargene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP41BRP41Rosa hybrid cultivargene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AM268395.1-BRP41.m1-cds1AM268395.1-BRP41.m1-cds1Rosa hybrid cultivarCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
BRP41AM268395.1-BRP41.p1Rosa hybrid cultivarpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AM268395 region AM268395:1..664+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productputative black spot resistance protein brp41
The following sequences are available for this feature:

mRNA sequence

>AM268395.1-BRP41.m1 ID=AM268395.1-BRP41.m1|Name=BRP41|organism=Rosa hybrid cultivar|type=mRNA|length=664bp
back to top

protein sequence of BRP41

>AM268395.1-BRP41.p1 ID=AM268395.1-BRP41.p1|Name=BRP41|organism=Rosa hybrid cultivar|type=polypeptide|length=221bp
back to top

mRNA from alignment at AM268395:1..664+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AM268395.1-BRP41.m1 ID=AM268395.1-BRP41.m1|Name=BRP41|organism=Rosa hybrid cultivar|type=mRNA|length=664bp|location=Sequence derived from alignment at AM268395:1..664+ (Rosa hybrid cultivar)
ggggggatggggaaaacgaccattgctagtgctgtttatgatgaaattgc tcctcaatttgaacactgttgctttcttgagaatatcaacgaaggtttca cgaagcatggggcagtatatatgcaagcaaaacttctatcaggaatgttg aaggaaaagatgcagagtttaggcaatttgaatgcaggttacaatatgat gatggaaaaactaggtatgaaaaaagttctagtcgtttttgatgatgtac ataatactacccagattgaagccttacttggaaaaccatattcatttggt tgtgggagtagaatcattataacaactagaaaggaaacaataatgagtgg atgtcagatatattgtcccaatctattagatgatgaagctgttaaactct tcaggcattttgctttcagaacaatcaattgctcagatgagtatgatctt ctctcacggcgtgccattggatgtgctcaacgtctgcctttagcacttaa agtcttaggatcttttctttttgacaaaagtatcgaagagtgggaagttg ccttgaaaggactagaaagattctctagcagaggagttgaaagtgtgttt tttaaaagctttgatgacctacatgattcagagaagaccatatttctcga tatcgcctgtttta
back to top

Coding sequence (CDS) from alignment at AM268395:1..664+

>AM268395.1-BRP41.m1 ID=AM268395.1-BRP41.m1|Name=BRP41|organism=Rosa hybrid cultivar|type=CDS|length=664bp|location=Sequence derived from alignment at AM268395:1..664+ (Rosa hybrid cultivar)
back to top