BRP40, AM075248.1-BRP40.m1 (mRNA) Rosa hybrid cultivar

Transcript Overview
Unique NameAM075248.1-BRP40.m1
OrganismRosa hybrid cultivar ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP40AM075248.1-BRP40Rosa hybrid cultivargene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP40BRP40Rosa hybrid cultivargene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AM075248.1-BRP40.m1-cds1AM075248.1-BRP40.m1-cds1Rosa hybrid cultivarCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
BRP40AM075248.1-BRP40.p1Rosa hybrid cultivarpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AM075248 region AM075248:1..527+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productputative LZ-NBS-LRR resistance protein
The following sequences are available for this feature:

mRNA sequence

>AM075248.1-BRP40.m1 ID=AM075248.1-BRP40.m1|Name=BRP40|organism=Rosa hybrid cultivar|type=mRNA|length=527bp
back to top

protein sequence of BRP40

>AM075248.1-BRP40.p1 ID=AM075248.1-BRP40.p1|Name=BRP40|organism=Rosa hybrid cultivar|type=polypeptide|length=175bp
back to top

mRNA from alignment at AM075248:1..527+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AM075248.1-BRP40.m1 ID=AM075248.1-BRP40.m1|Name=BRP40|organism=Rosa hybrid cultivar|type=mRNA|length=527bp|location=Sequence derived from alignment at AM075248:1..527+ (Rosa hybrid cultivar)
tttgaagtgaatacgattttaaaccagatgttagaatctctaaagaggga taaggcaggaatgacaaatcaagatgcattgcttaagtctcttgaagaag agctacaagggaagagatatgttcttatcctagatgatgtttggaatgaa gatagtataaaaggggaaagtttgaggagttgtttgtcaaagctcaattc tgctccgggaagcaacatcatcatcactacccgcagtgccaaggtggcat caatttcggaaacacttactcggtgtgagtkggtcaaactatcaaatgat gaatgttggtccatcttgaagcaaagagcattgttttcagatggcaatga tccaaaccgagagagaattggaaaggaaattgctaagaagtgtggaggcg tcccgttggtggcaaaggttttaggaggcatgatgcgtactaaaaatagt acgaaagaatggttgtcaattcaagcaagtcgaatatgggaattacccga agggtggaaagaatcatgtctgtttta
back to top

Coding sequence (CDS) from alignment at AM075248:1..527+

>AM075248.1-BRP40.m1 ID=AM075248.1-BRP40.m1|Name=BRP40|organism=Rosa hybrid cultivar|type=CDS|length=527bp|location=Sequence derived from alignment at AM075248:1..527+ (Rosa hybrid cultivar)
back to top