BRP34, AM075242.1-BRP34.m1 (mRNA) Rosa hybrid cultivar

Transcript Overview
Unique NameAM075242.1-BRP34.m1
OrganismRosa hybrid cultivar ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP34AM075242.1-BRP34Rosa hybrid cultivargene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP34BRP34Rosa hybrid cultivargene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AM075242.1-BRP34.m1-cds1AM075242.1-BRP34.m1-cds1Rosa hybrid cultivarCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
BRP34AM075242.1-BRP34.p1Rosa hybrid cultivarpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AM075242 region AM075242:1..642+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productputative LZ-NBS-LRR resistance protein
The following sequences are available for this feature:

mRNA sequence

>AM075242.1-BRP34.m1 ID=AM075242.1-BRP34.m1|Name=BRP34|organism=Rosa hybrid cultivar|type=mRNA|length=642bp
back to top

protein sequence of BRP34

>AM075242.1-BRP34.p1 ID=AM075242.1-BRP34.p1|Name=BRP34|organism=Rosa hybrid cultivar|type=polypeptide|length=214bp
back to top

mRNA from alignment at AM075242:1..642+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AM075242.1-BRP34.m1 ID=AM075242.1-BRP34.m1|Name=BRP34|organism=Rosa hybrid cultivar|type=mRNA|length=642bp|location=Sequence derived from alignment at AM075242:1..642+ (Rosa hybrid cultivar)
cttgccaagttggtctacaatgatgaaatggtcgttgggcatttcgattt gcggatgtgggtgtatgtgtcagtggactttgatattcataggctgatgg aaaagatccttagttctgcactaggtaaagaaatcagtgagaaaatgtct gtggatcaattacaagcaaagttacgtgagtcattgaaggataagaaata tttgcttgtcttggatgatgtatggaatgaggatcgtagtcaatggagtg acttgagaaatttgttgatagacgggatcaaattaggaagtaaaatctta gtgacaacccgtaatctctcagttgcttcaatcatgggcactgaacaacc atacaatttagctggcctttcttatgagtattgtttgtcattgtttacaa aatgtgcattcaaggaaggtgatgagaaacagcatccacacctctttgaa attggaaaagagattgtgaagaagtgcggaggggctccgttggcggtgag aactttagggagtcaactgtactcagagactgatgagcgtcgatggaaat tagtaagagattctaagatatgggaattggagagagggagtggtcatatc ttgcctgctttgagattgagttatattcaattgccttcatac
back to top

Coding sequence (CDS) from alignment at AM075242:1..642+

>AM075242.1-BRP34.m1 ID=AM075242.1-BRP34.m1|Name=BRP34|organism=Rosa hybrid cultivar|type=CDS|length=642bp|location=Sequence derived from alignment at AM075242:1..642+ (Rosa hybrid cultivar)
back to top