BRP2, AM075210.1-BRP2.m1 (mRNA) Rosa hybrid cultivar

Transcript Overview
Unique NameAM075210.1-BRP2.m1
OrganismRosa hybrid cultivar ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP2AM075210.1-BRP2Rosa hybrid cultivargene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP2BRP2Rosa hybrid cultivargene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AM075210.1-BRP2.m1-cds1AM075210.1-BRP2.m1-cds1Rosa hybrid cultivarCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
BRP2AM075210.1-BRP2.p1Rosa hybrid cultivarpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AM075210 region AM075210:1..562+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productputative TIR-NBS-LRR resistance protein
The following sequences are available for this feature:

mRNA sequence

>AM075210.1-BRP2.m1 ID=AM075210.1-BRP2.m1|Name=BRP2|organism=Rosa hybrid cultivar|type=mRNA|length=562bp
back to top

protein sequence of BRP2

>AM075210.1-BRP2.p1 ID=AM075210.1-BRP2.p1|Name=BRP2|organism=Rosa hybrid cultivar|type=polypeptide|length=187bp
back to top

mRNA from alignment at AM075210:1..562+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AM075210.1-BRP2.m1 ID=AM075210.1-BRP2.m1|Name=BRP2|organism=Rosa hybrid cultivar|type=mRNA|length=562bp|location=Sequence derived from alignment at AM075210:1..562+ (Rosa hybrid cultivar)
gttgccaaagccatctataacaaattttatcatgactttaacagtagaag tttcctagcagatgttagggaaacagcaaaggacccaagtggtaagattg cactgcaagaaagacttctttctgatgtcttaaaaccaaccaagatagag gtaggtgatgtttccaaaggcatcaatgtgatcaaagaacgacttagaag caaaaaggtacttgtcatcgttgacaatgtcgatcgtctggaacaattga atgcattcgcaataagccgtgattcctttggtctgggaggtataattatt ataacaacaagagatcgacatttgttacaacaagtgagagcggataaaat acatctgacacaagaaatgaatgaagaagaagctcttgagctcttcagtt ggcatgcctttcaaaattattctcctaaggaagactatatcgaactctca agaagagtggttacttactgtggaggtttaccgctggctcttgaagtttt agggtctttcctctttggaaggagcataggagattggaatagcacactga agaaattggaat
back to top

Coding sequence (CDS) from alignment at AM075210:1..562+

>AM075210.1-BRP2.m1 ID=AM075210.1-BRP2.m1|Name=BRP2|organism=Rosa hybrid cultivar|type=CDS|length=562bp|location=Sequence derived from alignment at AM075210:1..562+ (Rosa hybrid cultivar)
back to top