GLU3, EF177488.1-GLU3.m1 (mRNA) Prunus avium

Transcript Overview
Unique NameEF177488.1-GLU3.m1
OrganismPrunus avium ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GLU3GLU3Prunus aviumgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EF177488.1-GLU3.m1-cds1EF177488.1-GLU3.m1-cds1Prunus aviumCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
GLU3EF177488.1-GLU3.p1Prunus aviumpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EF177488 region EF177488:1..454+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productbeta-1,3-glucanase 3
The following sequences are available for this feature:

mRNA sequence

>EF177488.1-GLU3.m1 ID=EF177488.1-GLU3.m1|Name=GLU3|organism=Prunus avium|type=mRNA|length=454bp
back to top

protein sequence of GLU3

>EF177488.1-GLU3.p1 ID=EF177488.1-GLU3.p1|Name=GLU3|organism=Prunus avium|type=polypeptide|length=151bp
back to top

mRNA from alignment at EF177488:1..454+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF177488.1-GLU3.m1 ID=EF177488.1-GLU3.m1|Name=GLU3|organism=Prunus avium|type=mRNA|length=454bp|location=Sequence derived from alignment at EF177488:1..454+ (Prunus avium)
tacatcgcggtaggaaacgaagtcaagccctcagactcctttgcacaatt tcttgtcccggccatgcaaaacattcagaacgcaatttctagtgctggtt tgggaattaaagtttccactgccatagacactggagtgcttggaaagtcc tttcctccatcgaacggagagttcaagtccgaatatggagcacttttgaa cccaatcatccgcttcctagtgaacaacagatcgccgttgctggttaatt tgtacccttatttcagctacagcggcaacactcgtgacattcgtctagat tatgctcttttcacagctccatcagttgtggtacaagatggccaacgtgg ctatcgtaatcttttcgatgccattttggatgctgtttatgccgctcttg agaaggcgggcggagggtctttggaaattgtcatatccgagaccggttgg ccat
back to top

Coding sequence (CDS) from alignment at EF177488:1..454+

>EF177488.1-GLU3.m1 ID=EF177488.1-GLU3.m1|Name=GLU3|organism=Prunus avium|type=CDS|length=454bp|location=Sequence derived from alignment at EF177488:1..454+ (Prunus avium)
back to top