ACO2, AJ890087.1-ACO2.m1 (mRNA) Prunus domestica subsp. insititia

Transcript Overview
Unique NameAJ890087.1-ACO2.m1
OrganismPrunus domestica subsp. insititia ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ACO2ACO2Prunus domestica subsp. insititiagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AJ890087.1-ACO2.m1-cds1AJ890087.1-ACO2.m1-cds1Prunus domestica subsp. insititiaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ACO2AJ890087.1-ACO2.p1Prunus domestica subsp. insititiapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AJ890087 region AJ890087:1..912+ NCBI Rosaceae gene and mRNA sequences
scaffold_4 supercontig scaffold_4:642880..644080- Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Product1-aminocyclopropane-1-carboxylate oxidase 2
The following sequences are available for this feature:

mRNA sequence

>AJ890087.1-ACO2.m1 ID=AJ890087.1-ACO2.m1|Name=ACO2|organism=Prunus domestica subsp. insititia|type=mRNA|length=912bp
back to top

protein sequence of ACO2

>AJ890087.1-ACO2.p1 ID=AJ890087.1-ACO2.p1|Name=ACO2|organism=Prunus domestica subsp. insititia|type=polypeptide|length=304bp
back to top

mRNA from alignment at AJ890087:1..912+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AJ890087.1-ACO2.m1 ID=AJ890087.1-ACO2.m1|Name=ACO2|organism=Prunus domestica subsp. insititia|type=mRNA|length=912bp|location=Sequence derived from alignment at AJ890087:1..912+ (Prunus domestica subsp. insititia)
atggagactttcccagttgttgacttgagccaaattaatggtgaaaagag aggagctgccatggagaagataaacgatgcttgtgagaattggggtttct ttgagttggtgaaccatgggatatctcatgagctaatggatactgtggag aagctgacaaaggagcactacaaaaagtgcatggagcaaaggtttaagga aatggtcgcaaacaaaggccttgaagctgtccagtctgaaatccatgact tggactgggaaagcaccttcttcttgcgccaccttcctgtctctaacata tcccaaatccctgaccttgatgaagattacaggaaggtcatgaaagaatt tgcagtggaattagagaaactagctgagcaacttctggacttgctgtgtg agaatcttgggttggagaagggttatctgaagaaggctttctatggatca aagggaccaaactttgggacaaaggtcagcaactaccctccttgccccaa accagacctgatcaagggcctccgggcccacaccgatgcaggtggcatca tcctactcttccaagatgacaaggtcagcggcctccagctcctcaaggat ggtcaatggattgatgttcctccaatgcgccactccattgtcatcaactt aggtgaccaacttgaggtgatcactaatgggaaatacaagagtgttatgc accgtgtgctggcgcagccggatggtaccagaatgtccatagcctcattc tacaacccaggtgatgatgcttttatctgcccagcaccagcattgctgga aaaagaaactgagaaaatctcagtctaccccaaatttgtgtttgatgatt acatgaagctctattctggcctcaaattccaagccaaggaaccaagattt gaagccatgaag
back to top

Coding sequence (CDS) from alignment at AJ890087:1..912+

>AJ890087.1-ACO2.m1 ID=AJ890087.1-ACO2.m1|Name=ACO2|organism=Prunus domestica subsp. insititia|type=CDS|length=912bp|location=Sequence derived from alignment at AJ890087:1..912+ (Prunus domestica subsp. insititia)
back to top