ACO1, AB265798.1-ACO1.m1 (mRNA) Pyrus x bretschneideri

Transcript Overview
Unique NameAB265798.1-ACO1.m1
OrganismPyrus x bretschneideri ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ACO1ACO1Pyrus x bretschneiderigene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AB265798.1-ACO1.m1-cds1AB265798.1-ACO1.m1-cds1Pyrus x bretschneideriCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ACO1AB265798.1-ACO1.p1Pyrus x bretschneideripolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AB265798 region AB265798:1..770+ NCBI Rosaceae gene and mRNA sequences
scaffold00363 supercontig scaffold00363:227674..228886+ Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
Product1-aminocyclopropane-1-carboxylate oxidase
The following sequences are available for this feature:

mRNA sequence

>AB265798.1-ACO1.m1 ID=AB265798.1-ACO1.m1|Name=ACO1|organism=Pyrus x bretschneideri|type=mRNA|length=770bp
back to top

protein sequence of ACO1

>AB265798.1-ACO1.p1 ID=AB265798.1-ACO1.p1|Name=ACO1|organism=Pyrus x bretschneideri|type=polypeptide|length=256bp
back to top

mRNA from alignment at AB265798:1..770+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB265798.1-ACO1.m1 ID=AB265798.1-ACO1.m1|Name=ACO1|organism=Pyrus x bretschneideri|type=mRNA|length=770bp|location=Sequence derived from alignment at AB265798:1..770+ (Pyrus x bretschneideri)
ggtgagtcatgggattccaactgagtttctggacacagtggagaggctga caaaagagcactacaagcagtgtttggagcaaaggttcaaggagctggtg gccagcaaaggccttgagggtgttcagacagaagtcaaagatatggattg ggaaagcactttccacttgcgccatcttcctcaatcgaacatctctgaag taccagatctcaaggatgagtacaggaatgtgatgaaggagtttgcattg aaattggaaaaattagcagagcagctgctggacttgttgtgtgagaatct tggactggaacaagggtaccttaagaaggcattttatggaacaaagggac caactttcggcaccaaggtgagcaactaccctccatgtcctaacccagac ctgatcaagggtctccgggcccacaccgatgccggcggcctcatcttgct cttccaggatgacaaggtcagtggcctccagctcctcaaggacggagagt gggttgatgtgcctcccatgcgccactccattgttatcaatcttggtgac caacttgaggtgatcaccaacggaaagtacaagagtgtggaacacagggt gattgcccaaacagatggcaccagaatgtccatagcttcattctacaacc caggcagtgatgcggtgatctacccagcaccaaccctagtggagaaagaa gcagaagagaagaatcaagtgtacccgaagttcgtgttcgaagactacat gaagctctatgctggggtca
back to top

Coding sequence (CDS) from alignment at AB265798:1..770+

>AB265798.1-ACO1.m1 ID=AB265798.1-ACO1.m1|Name=ACO1|organism=Pyrus x bretschneideri|type=CDS|length=770bp|location=Sequence derived from alignment at AB265798:1..770+ (Pyrus x bretschneideri)
back to top