PL1, AB264095.1-PL1.m1 (mRNA) Prunus persica

Transcript Overview
Unique NameAB264095.1-PL1.m1
OrganismPrunus persica (Peach)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
PL1PL1Prunus persicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AB264095.1-PL1.m1-cds1AB264095.1-PL1.m1-cds1Prunus persicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
PL1AB264095.1-PL1.p1Prunus persicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AB264095 region AB264095:90..1331+ NCBI Rosaceae gene and mRNA sequences
scaffold_5 supercontig scaffold_5:14193936..14195645- Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Productpectate lyase
The following sequences are available for this feature:

mRNA sequence

>AB264095.1-PL1.m1 ID=AB264095.1-PL1.m1|Name=PL1|organism=Prunus persica|type=mRNA|length=1242bp
back to top

protein sequence of PL1

>AB264095.1-PL1.p1 ID=AB264095.1-PL1.p1|Name=PL1|organism=Prunus persica|type=polypeptide|length=413bp
back to top

mRNA from alignment at AB264095:90..1331+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB264095.1-PL1.m1 ID=AB264095.1-PL1.m1|Name=PL1|organism=Prunus persica|type=mRNA|length=1242bp|location=Sequence derived from alignment at AB264095:90..1331+ (Prunus persica)
atggcaaggccctccttaggcccctcacctctctctctcctcagcttcct cctcttctgtctcctcaccccaaccctcattgcctccagaccactgcagc aaaaccctgaattggttgtacaagatgtacaaaggagcatcaatgactct gtttctaggaggaacttgggctacttgtcatgcgggactggaaaccccat tgatgattgctggcgatgtgacccaaattgggagcagaacaggcagaggc tggcagattgcgcaattgggtttgggaaaaatgccattggtggaagagat ggcaagatttacgtggtcacggattcaggggataacgaccctgtaaaccc aaagccagggactctacgacatgccgttattcaggacgagccactgtgga tcatcttccagcgtgatatgacaatccaactgaaggaagagctgatcatg aactctttcaagaccatcgacggtcgaggagccagcgtgcacattgctgg tgggccatgcaatcaccgtccatttgtgaccaacattatcattcatggtc tgcacatacacgattgcaagccgggagggaatgctatggtgcggtcctcc ccagagcactacgggtggaggactatatccgacggtgacggtgtgtccat cttcggtgggagccacgtgtgggtggaccattgctctttgtcaaattgca aagatgggttggttgatgcaattcatgggtccactgccataacaatttcg aacaattacatgactcaccatgacaaagtgatgttgcttgggcatagcga ttcttataccgaagataagaacatgcaagtcaccatagccttcaatcact ttggagaaggtttggtccagagaatgccaagatgtaggcatggatatttc catgtggtgaacaatgactacacccattgggagatgtatgccattggagg cagtgccaaccctacaatcaatagccaagggaatagatttgctgcaccag atatcagatttagcaaagaggtgacaaaacatgaggatgcaccagaaagt gaatggaggaattggaattggaggtctgaaggagacttgatgataaatgg tgcattttttacagcatcaggagctggagcttcctcaagctatgcaaggg cttcaagcttgggggcaaagccatcttctctagtgggttcaataaccaca gcttctggtgcacttagctgcagaaagggttctcgttgctga
back to top

Coding sequence (CDS) from alignment at AB264095:90..1331+

>AB264095.1-PL1.m1 ID=AB264095.1-PL1.m1|Name=PL1|organism=Prunus persica|type=CDS|length=1242bp|location=Sequence derived from alignment at AB264095:90..1331+ (Prunus persica)
back to top