XET, AJ811689.1-XET.m1 (mRNA) Pyrus communis

Transcript Overview
Unique NameAJ811689.1-XET.m1
OrganismPyrus communis (European Pear)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
XETAJ811689.1-XETPyrus communisgene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
XETXETPyrus communisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AJ811689.1-XET.m1-cds1AJ811689.1-XET.m1-cds1Pyrus communisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
XETAJ811689.1-XET.p1Pyrus communispolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AJ811689 region AJ811689:664..1005+ NCBI Rosaceae gene and mRNA sequences
scaffold00807 supercontig scaffold00807:866..1208+ Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
Productxyloglucan endotransglycosilase
The following sequences are available for this feature:

mRNA sequence

>AJ811689.1-XET.m1 ID=AJ811689.1-XET.m1|Name=XET|organism=Pyrus communis|type=mRNA|length=342bp
back to top

protein sequence of XET

>AJ811689.1-XET.p1 ID=AJ811689.1-XET.p1|Name=XET|organism=Pyrus communis|type=polypeptide|length=113bp
back to top

mRNA from alignment at AJ811689:664..1005+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AJ811689.1-XET.m1 ID=AJ811689.1-XET.m1|Name=XET|organism=Pyrus communis|type=mRNA|length=342bp|location=Sequence derived from alignment at AJ811689:664..1005+ (Pyrus communis)
atgaagctctactccagcctgtggaacgcagacgattgggctactcgggg tggtctggaaaagaccgattggtccaaggccccgttcatcgccagctacc ggggcttccacatcgacggctgcgaggcctccgtcgaagccaagttttgt gccacccagggtaagaggtggtgggaccagaaggagttccaagaccttga tgctcagcaatggaggaggctgaggtgggtccgaaggaaattcaccatct acaactactgcatgaccgagtcagatacccttctatgccaccggagtgca agagggacagagacatataaaccaagagtaaattatgattag
back to top

Coding sequence (CDS) from alignment at AJ811689:664..1005+

>AJ811689.1-XET.m1 ID=AJ811689.1-XET.m1|Name=XET|organism=Pyrus communis|type=CDS|length=342bp|location=Sequence derived from alignment at AJ811689:664..1005+ (Pyrus communis)
back to top