ANR, DQ438979.1-ANR.m1 (mRNA) Fragaria x ananassa

Transcript Overview
Unique NameDQ438979.1-ANR.m1
OrganismFragaria x ananassa (Strawberry)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ANRANRFragaria x ananassagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
DQ438979.1-ANR.m1-cds1DQ438979.1-ANR.m1-cds1Fragaria x ananassaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ANRDQ438979.1-ANR.p1Fragaria x ananassapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
DQ438979 region DQ438979:1..1020+ NCBI Rosaceae gene and mRNA sequences
LG5 chromosome LG5:66912..68686+ Fragaria vesca Whole Genome v1.0 (build 8) Assembly & Annotation
Property NameValue
Productanthocyanidin reductase
The following sequences are available for this feature:

mRNA sequence

>DQ438979.1-ANR.m1 ID=DQ438979.1-ANR.m1|Name=ANR|organism=Fragaria x ananassa|type=mRNA|length=1020bp
back to top

protein sequence of ANR

>DQ438979.1-ANR.p1 ID=DQ438979.1-ANR.p1|Name=ANR|organism=Fragaria x ananassa|type=polypeptide|length=339bp
back to top

mRNA from alignment at DQ438979:1..1020+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ438979.1-ANR.m1 ID=DQ438979.1-ANR.m1|Name=ANR|organism=Fragaria x ananassa|type=mRNA|length=1020bp|location=Sequence derived from alignment at DQ438979:1..1020+ (Fragaria x ananassa)
atgtccaccacccaacccatcatctcaacaaagtctgcttgtgtcatcgg cggcaccggcttcgtggcgtctcagctaatcaagctcttgctagagaagg gctatgccgtcagaaccactgttagagacccagataatctgaagaagatc tcccacctaacagcactacaagagttgggagagctaacaatatttcgtgg ggatttaaccgatgaagggagctttgatgctgctatagcaggttctgatc ttgttttccatgtagccacaccagtccactttggctcgccggatccagag aacgacatgatcaagccaggagtccaaggagtactaaacgttatgaaatc atgtgtgaaagcaaaaacagttaaacgagtcgttttgacatcatcagcag ctgcagtaactgtcaatactcttagtggaacaggcttgattgccgacgaa aatgattggtctgatgttgagttcttgaccactgccaagccacctacctg gggatatcctgtttcaaaggtactagctgagaagacagcatggaaatttg ctgaacaaaacaacattgatctcatcgctgtgatcccttctctcatggct ggtgcttctctcactccagacatccccagcagtataggcctcgccacgtc tttaatcacaggaaatgagttcctcataaatggcttgaaaggcatgcaaa tgctatcaggttccatatccattacacatgtggaggatgtctgccgagct catatatttttggcagagaaagaatctgcttctggtcggtacatatgctg tgctgaaaatagtagtgttcctgaggttgcaaagttcctcagcaaaagat atcctgaatacaaagtcccgactgagtttggagattttccatccaaggcg aagaccatactcccctcagaaaagcttaagaaggaggggttcactttcaa gttcgggattgaagacatatatgaccaaactgtggagtacttgaaactta agggggtgctgcagaactag
back to top

Coding sequence (CDS) from alignment at DQ438979:1..1020+

>DQ438979.1-ANR.m1 ID=DQ438979.1-ANR.m1|Name=ANR|organism=Fragaria x ananassa|type=CDS|length=1020bp|location=Sequence derived from alignment at DQ438979:1..1020+ (Fragaria x ananassa)
back to top