GAPDH-1, AB266449.1-GAPDH-1.m1 (mRNA) Pyrus pyrifolia var. culta

Transcript Overview
Unique NameAB266449.1-GAPDH-1.m1
OrganismPyrus pyrifolia var. culta ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDH-1GAPDH-1Pyrus pyrifolia var. cultagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AB266449.1-GAPDH-1.m1-cds1AB266449.1-GAPDH-1.m1-cds1Pyrus pyrifolia var. cultaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
GAPDH-1AB266449.1-GAPDH-1.p1Pyrus pyrifolia var. cultapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AB266449 region AB266449:1..733+ NCBI Rosaceae gene and mRNA sequences
scaffold00586 supercontig scaffold00586:126253..127963- Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
Productglyceraldehyde-3-phosphate dehydrogenase like protein
The following sequences are available for this feature:

mRNA sequence

>AB266449.1-GAPDH-1.m1 ID=AB266449.1-GAPDH-1.m1|Name=GAPDH-1|organism=Pyrus pyrifolia var. culta|type=mRNA|length=733bp
back to top

protein sequence of GAPDH-1

>AB266449.1-GAPDH-1.p1 ID=AB266449.1-GAPDH-1.p1|Name=GAPDH-1|organism=Pyrus pyrifolia var. culta|type=polypeptide|length=243bp
back to top

mRNA from alignment at AB266449:1..733+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB266449.1-GAPDH-1.m1 ID=AB266449.1-GAPDH-1.m1|Name=GAPDH-1|organism=Pyrus pyrifolia var. culta|type=mRNA|length=733bp|location=Sequence derived from alignment at AB266449:1..733+ (Pyrus pyrifolia var. culta)
ttgagctagttgctgttaatgatcccttcatcaccaccgactacatgacc tacatgttcaagtacgacacagtccatggcgcatggaagcaccatgagct caaggtcaaggactccaagacccttctcttcggtgagaagcctgttgctg ttttcggaatcaggaacccagaggagatcccatggggtgagaccggtgct gactttgttgttgagtctaccggtgtcttcaccgacaaggagaaagctgc tgcccatatcaagggaggtgcaaagaaggttatcatctctgctcccagca aggatgctcccatgttcgttgttggtgtgaacgagaaggaatataagcca gacattcacattctttccaatgccagttgcactaccaactgccttgctcc ccttgccaaggttatcaacgacaggtttgggattgttgagggtctcatga ccacggtgcactccatcactgccacccaaaagactgtcgacggtccatca atgaaggactggagaggtggacgtgctgcttccttcaacatcattcctag cagcactggagctgccaaggctgttggaaaggtgctcccatctcttaatg gaaaattgaccggaatgtccttccgtgtgcccactgttgatgtttccgtt gttgacctgactgtcaggctggagaagcctgcaacctatgaacagatcaa ggccgctatcaaggaggagtcagaaggcaaaat
back to top

Coding sequence (CDS) from alignment at AB266449:1..733+

>AB266449.1-GAPDH-1.m1 ID=AB266449.1-GAPDH-1.m1|Name=GAPDH-1|organism=Pyrus pyrifolia var. culta|type=CDS|length=733bp|location=Sequence derived from alignment at AB266449:1..733+ (Pyrus pyrifolia var. culta)
back to top