FRK, DQ641517.1-FRK.m1 (mRNA) Fragaria x ananassa

Transcript Overview
Unique NameDQ641517.1-FRK.m1
OrganismFragaria x ananassa (Strawberry)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
FRKFRKFragaria x ananassagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
DQ641517.1-FRK.m1-cds1DQ641517.1-FRK.m1-cds1Fragaria x ananassaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
FRKDQ641517.1-FRK.p1Fragaria x ananassapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
DQ641517 region DQ641517:1..552+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>DQ641517.1-FRK.m1 ID=DQ641517.1-FRK.m1|Name=FRK|organism=Fragaria x ananassa|type=mRNA|length=552bp
back to top

protein sequence of FRK

>DQ641517.1-FRK.p1 ID=DQ641517.1-FRK.p1|Name=FRK|organism=Fragaria x ananassa|type=polypeptide|length=183bp
back to top

mRNA from alignment at DQ641517:1..552+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ641517.1-FRK.m1 ID=DQ641517.1-FRK.m1|Name=FRK|organism=Fragaria x ananassa|type=mRNA|length=552bp|location=Sequence derived from alignment at DQ641517:1..552+ (Fragaria x ananassa)
ttcgagggagatgttaatcgatttcgtcccaaccacgaatggactttcac tggctgatgcacctgcatttaaaaaagctgctggaggtgcccctgcaaat gttgcagttggcatagctcgtctaggtggctcatcagcctttattgggaa ggtgggggaagatgaatttgggtacatgcttgctgatatattaaaggaga ataatgtcaacaatgaagggatgcgttttgatcctggtgcacgaactgct ttagcatttgttacattgaggagtgatagggaacgtgagttcatgtttta tcgtaatcctagtgctgatatgttgcttcaagaagctgaacttgatttag atttaataaggaaggcaaaaatattgcactatggatctataagtcttatt acagaaccatgcaagtccacccatattgcagcagcaaaagctgcaaagga actggtgttgttttggtcatatgatcccaacctcaggcttccgctgtggc cttctgcaaaaagtgccagaaaaagaaattttgagtatgtgggaaactgc tg
back to top

Coding sequence (CDS) from alignment at DQ641517:1..552+

>DQ641517.1-FRK.m1 ID=DQ641517.1-FRK.m1|Name=FRK|organism=Fragaria x ananassa|type=CDS|length=552bp|location=Sequence derived from alignment at DQ641517:1..552+ (Fragaria x ananassa)
back to top