ACO2, AJ851829.1-ACO2.m1 (mRNA) Fragaria x ananassa

Transcript Overview
Unique NameAJ851829.1-ACO2.m1
OrganismFragaria x ananassa (Strawberry)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ACO2ACO2Fragaria x ananassagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AJ851829.1-ACO2.m1-cds1AJ851829.1-ACO2.m1-cds1Fragaria x ananassaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ACO2AJ851829.1-ACO2.p1Fragaria x ananassapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AJ851829 region AJ851829:1..478+ NCBI Rosaceae gene and mRNA sequences
LG3 chromosome LG3:893421..893977+ Fragaria vesca Whole Genome v1.0 (build 8) Assembly & Annotation
Property NameValue
Product1-aminocyclopropane-1-carboxylate oxidase
Functionethylene biosynthesis
The following sequences are available for this feature:

mRNA sequence

>AJ851829.1-ACO2.m1 ID=AJ851829.1-ACO2.m1|Name=ACO2|organism=Fragaria x ananassa|type=mRNA|length=478bp
back to top

protein sequence of ACO2

>AJ851829.1-ACO2.p1 ID=AJ851829.1-ACO2.p1|Name=ACO2|organism=Fragaria x ananassa|type=polypeptide|length=158bp
back to top

mRNA from alignment at AJ851829:1..478+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AJ851829.1-ACO2.m1 ID=AJ851829.1-ACO2.m1|Name=ACO2|organism=Fragaria x ananassa|type=mRNA|length=478bp|location=Sequence derived from alignment at AJ851829:1..478+ (Fragaria x ananassa)
ttgagctggtgagccatgggatatcccatgagttgatggacaaggtggag aagctcacaaaggagcactacagaaagtgcatggagcaaaggttcaagga aatggtggcaagcaaaggtctcgaagctgtcaactctgaaatcgaagatt tggactgggaaagcaccttcttcttgcgccatctccccttctccaacatt tcccaagtccccgatctcgacgaagattacagggaggccatgaaggaatt tgcagtggaactagagaagctggctgagcaactactggacttgttgtgtg agaatctggggctggagaagggttacctgaagaaggctttctatggatcc aagggaccaaattttggtaccaaggtgagcaactaccctccatgccccaa accggacctggtcaagggactccgggcccacaccgatgccggaggcgtca tcctgctgttccaagatgacaaggtcag
back to top

Coding sequence (CDS) from alignment at AJ851829:1..478+

>AJ851829.1-ACO2.m1 ID=AJ851829.1-ACO2.m1|Name=ACO2|organism=Fragaria x ananassa|type=CDS|length=478bp|location=Sequence derived from alignment at AJ851829:1..478+ (Fragaria x ananassa)
back to top