HMG3, AY043491.2-HMG3.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameAY043491.2-HMG3.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
HMG3HMG3Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AY043491.2-HMG3.m1-cds1AY043491.2-HMG3.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
HMG3AY043491.2-HMG3.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AY043491 region AY043491:1..1140+ NCBI Rosaceae gene and mRNA sequences
Chr02 chromosome Chr02:8742015..8744240- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr2 chromosome chr2:8562396..8564622+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Product3-hydroxy-3-methylglutaryl coenzyme A reductase
The following sequences are available for this feature:

mRNA sequence

>AY043491.2-HMG3.m1 ID=AY043491.2-HMG3.m1|Name=HMG3|organism=Malus x domestica|type=mRNA|length=1140bp
back to top

protein sequence of HMG3

>AY043491.2-HMG3.p1 ID=AY043491.2-HMG3.p1|Name=HMG3|organism=Malus x domestica|type=polypeptide|length=379bp
back to top

mRNA from alignment at AY043491:1..1140+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AY043491.2-HMG3.m1 ID=AY043491.2-HMG3.m1|Name=HMG3|organism=Malus x domestica|type=mRNA|length=1140bp|location=Sequence derived from alignment at AY043491:1..1140+ (Malus x domestica)
aaacgcggttcgttcgctggagggcctgccgtggagggattcgattatcg gtcgatactgggacagtgctgtgagaatccggtggggtatgtgcagatcc cggtgggagtcgccggaccgctgcttctcgacggagaagagtacatggtg ccaatggcgacaacggaggggtgcctggtggccagcaccaataggggatt caaggcaatctacgcctcaggcggcgccgagagtgtcctcttcaacgact ccatgaccagagctccaattgtgaggttccactccgtcgttagggctgct cagctcaagttcttcgtcgagaaccctctcaattttgatgctctcgccgt cgttttcaacatgtctagcagatttgcaaagctcgaaaagattcgatgcg cgatagcaggcaggaatctgtacctaaggttttcatgcagcactggagat gccatggggatgaacatgatctccaaaggcgtccaatgtgttatcgaatt ccttcaaaatgaattcccagacatggaagttgttggcatctctggaaact tctgctcagacaagaaagcagcagccgtaaattggattgaagggcgaggg aaatcagtaacttgcgaggcagtcatcaaggaggaattggtgaggaaagt actgaaaaccgatgtggattcccttgtgaagcttaacgtgaataaaaacc ttgttgggtctgccatggctggtgctcttggcgggttcaacgcccacgcc agcaatattgtctctgcagtcttcatagccactggccaggaccctgctca gaatattgagagctctcactgcattaccttgatggaagccgacggcaatg accttcatatctcagtcaccatgccttccattgaggtgggtacagttgga ggaggaacacaactcgcatcccaatcagcctgcttgaacttgctcggtgt caagggcgcaggcaaagactctccaggtttaaactcaaggcaactggcga gaattgtagctggagctgtcctagcaggggagctttctctcatgtcagcc atcgcatccgggcagctagtgaagagccacatgaaatacaaccgatctaa cccagacgttgcaaaccttgcctcggtaaaacaccggtag
back to top

Coding sequence (CDS) from alignment at AY043491:1..1140+

>AY043491.2-HMG3.m1 ID=AY043491.2-HMG3.m1|Name=HMG3|organism=Malus x domestica|type=CDS|length=1140bp|location=Sequence derived from alignment at AY043491:1..1140+ (Malus x domestica)
back to top