ADC, AB181854.1-ADC.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameAB181854.1-ADC.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ADCADCMalus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AB181854.1-ADC.m1-cds1AB181854.1-ADC.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ADCAB181854.1-ADC.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AB181854 region AB181854:677..2863+ NCBI Rosaceae gene and mRNA sequences
Chr05 chromosome Chr05:9464565..9466751+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
unanchored chromosome unanchored:7183817..7186003+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Productarginine decarboxylase
The following sequences are available for this feature:

mRNA sequence

>AB181854.1-ADC.m1 ID=AB181854.1-ADC.m1|Name=ADC|organism=Malus x domestica|type=mRNA|length=2187bp
back to top

protein sequence of ADC

>AB181854.1-ADC.p1 ID=AB181854.1-ADC.p1|Name=ADC|organism=Malus x domestica|type=polypeptide|length=728bp
back to top

mRNA from alignment at AB181854:677..2863+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB181854.1-ADC.m1 ID=AB181854.1-ADC.m1|Name=ADC|organism=Malus x domestica|type=mRNA|length=2187bp|location=Sequence derived from alignment at AB181854:677..2863+ (Malus x domestica)
atgccggccctggcttgttgcgtggatgctgctgtggcgcctcccggcca cgctttcgccggggatagctctcttcccgcgtcgccgttcccaggcttac ctccggcgaccatcaccaccgccgccgacaattcccattggtccccttcc ctctcgtccgacctctaccgaatagacgcctggggtgggccctacttcac cgtcaactcctccggcaacgtcgccgtccgtcctcatgggacggcgactc tgcctcaccaggagattgatctgctgaagatcgtgaagaaggtttcggat tcaaaaccggagtgcggacttgggttgcagctgccgctcattgttcgcct ccctgatgtgctcaaggaccggctcgagtccctccagggcgccttcgatc tggcgatccggtcccacgactacggctcccactaccagggcgtgtacccg gtgaaatgcaaccaggaccggttcgtcgtggaggacattgtcaagttcgg gtccccgttccggttcggactggaagccgggtcgaagccggagctcctct tggccatgagctgcttgtgcaaaggtcatcccgacgcccttctcatctgc aatggattcaaagaccttgagtacatctctctggctctgttcgcccgcaa gctcgccttgaacactgtgattgttcttgagcaagaggaggagctcgatt tggttgttgatttcagccaaaagctcggcgtacgacccgtgattggcgtc cgggccaagctcaagaccaagcattcgggccatttcggttcgacttccgg cgaggagggaaagttcggactcaccaccactcagattttacgcgttgtga agaagcttgataagctgggtatgcttgattgctttcagttgttgcatttt cataccgggtctcagatcccttcgacggccctgctcgctgatggcgtatc cgaggcatcgcagatatattgcgaattggtccgtctcggtgcccacatga aggtcatagacattggaggcggtctgggtattgattacgatggatccaaa tctagtgactcggagatttcggtcagctacggccttgaagagtatgcctc cgccgttgtccgaacggttcggaacgtctgtgaacggaggtccgtgaagc acccggtgatttgcagtgaaagcggccgagccttggtttcccaccactcg gttctcatatttgaggctatttcttccagtgcttgtgatgatgctcctcc catgtccgcctttgagcatcagtacttcattgagggtctgacggatgaag ctcgtgccgattacctgaacctctccgctgcggctatcagaggtgagtac gaggcttgtttgacgtatgctgatctgttgaaacaacggagtgttgaaca attcaaagaagggtctgtcggtattgagcaattggccaccgtcgatgggt tctgtgatatgttttcgaaagcaatcggggcatctgacgctgtccgtaca taccatgtgaatctctcggtattcacttcaattccagacttctggggtat tgggcagacgttccccatagtcccgattcaccgcctcgatcaatggcctg cagtgaggggagtattgtcagacttgacctgtgacagtgatgggaaaatc gacaagttcattggcggcgggtctagcttgccgctgcatgagctggaagg cgatggtgggaataatggcggtgggcaaaagtactatttggggatgttcc tgggcggggcttatcaggaggcgctcggaggagtccacaacctcttcggt ggcccgagcattgttcgggtttcgcagagcgatggtccccacagcttcgc ggtgacgggagctgtgtcaggtccgtcatgtggggacgtcctgcgggtga tgcagcatgagcccgagctcatgtttgagacgctgaagcaccgcgcggag gagtgcgggcagggtgacgatgggggaatggccagtgccgctgtggccac cagcctggcccggtccttccacaacatgccgtacctggtgtcagcttctt cttgtagcctgactgcaatgaataaccatgggttctactattgcagcgag gatgattacggcgacattgttgccgattcggcgggggctgctgctcccgt tggcgaggaagaacagtggtcttattgctgtgcttaa
back to top

Coding sequence (CDS) from alignment at AB181854:677..2863+

>AB181854.1-ADC.m1 ID=AB181854.1-ADC.m1|Name=ADC|organism=Malus x domestica|type=CDS|length=2187bp|location=Sequence derived from alignment at AB181854:677..2863+ (Malus x domestica)
back to top