GLU, AJ002748.1-GLU.m1 (mRNA) Prunus persica

Transcript Overview
Unique NameAJ002748.1-GLU.m1
OrganismPrunus persica (Peach)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GLUGLUPrunus persicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AJ002748.1-GLU.m1-cds1AJ002748.1-GLU.m1-cds1Prunus persicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
GLUAJ002748.1-GLU.p1Prunus persicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AJ002748 region AJ002748:13..156+ NCBI Rosaceae gene and mRNA sequences
scaffold_1 supercontig scaffold_1:9112831..9112974- Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>AJ002748.1-GLU.m1 ID=AJ002748.1-GLU.m1|Name=GLU|organism=Prunus persica|type=mRNA|length=144bp
back to top

protein sequence of GLU

>AJ002748.1-GLU.p1 ID=AJ002748.1-GLU.p1|Name=GLU|organism=Prunus persica|type=polypeptide|length=47bp
back to top

mRNA from alignment at AJ002748:13..156+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AJ002748.1-GLU.m1 ID=AJ002748.1-GLU.m1|Name=GLU|organism=Prunus persica|type=mRNA|length=144bp|location=Sequence derived from alignment at AJ002748:13..156+ (Prunus persica)
atgtttgatgagaataacaaactaggtgaagaaacagagagacactttgg ggtgttcttcccaactaaagagccaaagtataacctcaatttcgatactt ccgctgggtataatactacaaatacccttaacactgacatgtaa
back to top

Coding sequence (CDS) from alignment at AJ002748:13..156+

>AJ002748.1-GLU.m1 ID=AJ002748.1-GLU.m1|Name=GLU|organism=Prunus persica|type=CDS|length=144bp|location=Sequence derived from alignment at AJ002748:13..156+ (Prunus persica)
back to top