DREB1, AB121674.1-DREB1.m1 (mRNA) Prunus avium

Transcript Overview
Unique NameAB121674.1-DREB1.m1
OrganismPrunus avium ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
DREB1DREB1Prunus aviumgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AB121674.1-DREB1.m1-cds1AB121674.1-DREB1.m1-cds1Prunus aviumCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
DREB1AB121674.1-DREB1.p1Prunus aviumpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AB121674 region AB121674:61..783+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productdehydration responsive element binding protein 1
Genbank noteC-repeat binding factor; CBF
The following sequences are available for this feature:

mRNA sequence

>AB121674.1-DREB1.m1 ID=AB121674.1-DREB1.m1|Name=DREB1|organism=Prunus avium|type=mRNA|length=723bp
back to top

protein sequence of DREB1

>AB121674.1-DREB1.p1 ID=AB121674.1-DREB1.p1|Name=DREB1|organism=Prunus avium|type=polypeptide|length=240bp
back to top

mRNA from alignment at AB121674:61..783+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB121674.1-DREB1.m1 ID=AB121674.1-DREB1.m1|Name=DREB1|organism=Prunus avium|type=mRNA|length=723bp|location=Sequence derived from alignment at AB121674:61..783+ (Prunus avium)
atggacatgttcttctctcaactttcagactcggtcgaccagccccagtc gagtttgttgtccgacgccagcgtcaccactcgaggggcttcttgttccg acggggacgtcatattggcgtcgagccggccgaagaagcgagcggggagg agggttttcaaggagacgaggcacccggtttataggggtgtgaggaggag gaacaatgacaagtgggtgtgtgaaatgagagagcccaacaagaagaagt ccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcc catgacgtggccgcattggcgtttagagggaagcttgcatgcatcaactt tgctgactcagcgtggaggctgcccgtgccggcttccatggataccatgg atattcggagggcggccgcagaggcagctgaggggtttaggccggtggag tttggtggagtgtgcagcggcagcagtgatgagaaggagagaatggtggt gcaggtggaagagaagaacaagaagggtagtgtgaacttggaaagaagca gaagcttgagcttgtcctattgggatgaggaggaagtgtttcacatgccc aggttgcttcatgacatggctgaagggcttcttctttctccatcgcaatg cttaggtggctacatgaatttggatgacatgggcaccgatgctgatgtca aattgtggagtttctccatttaa
back to top

Coding sequence (CDS) from alignment at AB121674:61..783+

>AB121674.1-DREB1.m1 ID=AB121674.1-DREB1.m1|Name=DREB1|organism=Prunus avium|type=CDS|length=723bp|location=Sequence derived from alignment at AB121674:61..783+ (Prunus avium)
back to top