ACO3, AB042107.1-ACO3.m1 (mRNA) Pyrus pyrifolia

Transcript Overview
Unique NameAB042107.1-ACO3.m1
OrganismPyrus pyrifolia ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ACO3ACO3Pyrus pyrifoliagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AB042107.1-ACO3.m1-cds1AB042107.1-ACO3.m1-cds1Pyrus pyrifoliaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ACO3AB042107.1-ACO3.p1Pyrus pyrifoliapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AB042107 region AB042107:49..1017+ NCBI Rosaceae gene and mRNA sequences
scaffold00363 supercontig scaffold00363:227453..228978+ Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
Product1-aminocyclopropane-1-carboxylate oxidase
The following sequences are available for this feature:

mRNA sequence

>AB042107.1-ACO3.m1 ID=AB042107.1-ACO3.m1|Name=ACO3|organism=Pyrus pyrifolia|type=mRNA|length=969bp
back to top

protein sequence of ACO3

>AB042107.1-ACO3.p1 ID=AB042107.1-ACO3.p1|Name=ACO3|organism=Pyrus pyrifolia|type=polypeptide|length=322bp
back to top

mRNA from alignment at AB042107:49..1017+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB042107.1-ACO3.m1 ID=AB042107.1-ACO3.m1|Name=ACO3|organism=Pyrus pyrifolia|type=mRNA|length=969bp|location=Sequence derived from alignment at AB042107:49..1017+ (Pyrus pyrifolia)
atggagaacttcccagttatcaacttggagagcctcaatggtgagggaag aaaagctacaatggaaaagatcaaagatgcctgtgagaactggggtttct ttgagctggtgagtcatgggattccaactgagttactggacacagtggag aggctgacaaaagagcactacaagcagtgtttggagcaaaggttcaagga gctggtggccagcaaaggccttgagggtgttcagacagaagtcaaagata tggattgggaaagcactttccacttgcgccatcttcctcaatcgaacatc tctgaagtaccagatctcaaggatgagtacaggaatgtgatgaaggagtt tgcattgaaattggaaaaattagcagagcagctgctggacttgttgtgtg agaatcttggactggaacaagggtaccttaagaaggcattttatggaaca aagggaccaactttcggcaccaaggtgagcaactaccctccatgtcctaa cccagacctgatcaagggtctccgggcccacaccgatgccggcggcctca tcttgctcttccaggatgacaaggtcagtggcctccagctcctcaaggac ggagagtgggttgatgtgcctcccatgcgccactccattgttatcaatct tggtgaccaacttgaggtgatcaccaacggaaagtacaagagtgtggaac acagggtgattgcccaaacagatggcaccagaatgtccatagcttcattc tacaacccaggcagtgatgcggtgatctacccagcaccaaccctagtgga gaaagaagcagaagagaagaatcaagtgtacccgaagttcgtgttcgaag actacatgaagctctatgctggggtcaagttcgagcccaaggaaccaaga tttgaagccatgaaagcagtggaaattaaggccagttttggtttgggtcc agttataagtactgcttga
back to top

Coding sequence (CDS) from alignment at AB042107:49..1017+

>AB042107.1-ACO3.m1 ID=AB042107.1-ACO3.m1|Name=ACO3|organism=Pyrus pyrifolia|type=CDS|length=969bp|location=Sequence derived from alignment at AB042107:49..1017+ (Pyrus pyrifolia)
back to top