F3H, AB074486.1-F3H.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameAB074486.1-F3H.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
F3HF3HMalus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AB074486.1-F3H.m1-cds1AB074486.1-F3H.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
F3HAB074486.1-F3H.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AB074486 region AB074486:1..1098+ NCBI Rosaceae gene and mRNA sequences
Chr15 chromosome Chr15:20430087..20432070+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr5 chromosome chr5:20985662..20987645+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr5 chromosome chr5:23800735..23802718- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
Productflavanone 3-hydroxylase
The following sequences are available for this feature:

mRNA sequence

>AB074486.1-F3H.m1 ID=AB074486.1-F3H.m1|Name=F3H|organism=Malus x domestica|type=mRNA|length=1098bp
back to top

protein sequence of F3H

>AB074486.1-F3H.p1 ID=AB074486.1-F3H.p1|Name=F3H|organism=Malus x domestica|type=polypeptide|length=365bp
back to top

mRNA from alignment at AB074486:1..1098+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB074486.1-F3H.m1 ID=AB074486.1-F3H.m1|Name=F3H|organism=Malus x domestica|type=mRNA|length=1098bp|location=Sequence derived from alignment at AB074486:1..1098+ (Malus x domestica)
atggctcctcctgctactacgctgacatccattgcgcatgagaaaaccct acaacaaaaattcgtccgagacgaagacgagcgtccaaaggttgcctaca acgaattcagcaacgaaattccgatcatctcgcttgccgggatcgatgag gttgaaggccgccgggccgagatttgcaagaagattgtggaagcttgtga ggactggggtattttccagattgttgatcatggagttgatgccgagctca tatcggaaatgaccggtctcgccaaagagttctttgatttgccatcggag gagaagctccgcttcgacatgtccggtggcaaaaagggtggattcatcgt gtccagtcatttacagggagaagctgtgcaagattggcgtgaaattgtga cctactttttatacccgattcgccaccgggactactcgaggtggccggac aagccagaggcatggagggaggtgacgaagaagtacagcgacgagctgat ggggctggcatgcaagctcttgggggttttatcagaagccatggggttgg atacagaggcattgacaaaggcatgtgtggacatggaccaaaaagtggtg gtgaatttctatccgaagtgccctcagcccgacctaactcttggcctcaa gcgccacacggacccgggcacaattacccttttgcttcaggaccaagttg gtggccttcaggctactagggatgatgggaagacatggatcaccgttcaa ccagtggaaggagcttttgtggtcaatctcggagatcatggtcattttct gagcaatgggaggttcaagaatgctgatcaccaagcagtggtgaactcaa acagcagcaggctgtccatagccacattccagaacccagctcaagatgca atagtgtatccactcagtgtgagggagggagagaagccgattctcgaggc gccgatcacctacaccgagatgtacaagaagaagatgagcaaagatcttg agcttgccaggctgaaaaagctggccaaggaacagcaactgcaggacttg gagaaagccaaagtggagacaaagccagcggacgacatatttgcttag
back to top

Coding sequence (CDS) from alignment at AB074486:1..1098+

>AB074486.1-F3H.m1 ID=AB074486.1-F3H.m1|Name=F3H|organism=Malus x domestica|type=CDS|length=1098bp|location=Sequence derived from alignment at AB074486:1..1098+ (Malus x domestica)
back to top