Sg-RNase, AB093131.1-Sg-RNase.m1 (mRNA) Prunus salicina

Transcript Overview
Unique NameAB093131.1-Sg-RNase.m1
OrganismPrunus salicina ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
Sg-RNaseSg-RNasePrunus salicinagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AB093131.1-Sg-RNase.m1-cds1AB093131.1-Sg-RNase.m1-cds1Prunus salicinaCDS
AB093131.1-Sg-RNase.m1-cds2AB093131.1-Sg-RNase.m1-cds2Prunus salicinaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
Sg-RNaseAB093131.1-Sg-RNase.p1Prunus salicinapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AB093131 region AB093131:1..1266+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>AB093131.1-Sg-RNase.m1 ID=AB093131.1-Sg-RNase.m1|Name=Sg-RNase|organism=Prunus salicina|type=mRNA|length=239bp
back to top

protein sequence of Sg-RNase

>AB093131.1-Sg-RNase.p1 ID=AB093131.1-Sg-RNase.p1|Name=Sg-RNase|organism=Prunus salicina|type=polypeptide|length=79bp
back to top

mRNA from alignment at AB093131:1..1266+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB093131.1-Sg-RNase.m1 ID=AB093131.1-Sg-RNase.m1|Name=Sg-RNase|organism=Prunus salicina|type=mRNA|length=1266bp|location=Sequence derived from alignment at AB093131:1..1266+ (Prunus salicina)
ccatggaagcccagtaattgcagtgggtcgcaatttaaggacgggaaagt ggtatgtattgtttcaattttttctttttgtttcacttactcttagaaaa ttagattgtcatatatatgaagatcatatattttattcaataaaccttga gtgttggataaaagtttggtgttggtcatctgctaggcacattattcaga atatcttttgaaatatatagctaactgcaaaattataagtacatttatac tcayaggtgtaattgatgtacttgtgtataaattatagccaaaaatttac tttcggtatctgtagtttgccaatttttaccactttggtccttataattt taattttgtcaattttattcttgtggtttcaattcggagcaatttaagga catgtttcagtttctgtcaaagtccttgaaattccacttttatctagtaa ttccattgtcaattttatccttgtagttttcaatttagagcaagtcaagg acacattccaatttttgtcaaatccttcccaattctgttgagtttttatc acgcaccactcacgtgaaagggtggtttgttcctcccatgtcacccaaat tttaacccaaagatgcaattttttttcttttgaaaccctaatcccaaaaa ttgtgcctaaagtggatgggaagagctccaccttgtgttttacctttaga tggttcgagtggactgaaatacctttgggcacatggtcaaaacttaacag aattggaggaatttgatagaaattgaaatgtgtcgttttgaattgaaaac tataaggacaaaatcaaaactatggaaccaatgtagtaaaatcaataaat tatagggaccaaaagtaacgttttgtcaagaatcgaaatggtaatattgt ctccatttagttggaggtcttggttcaattcacatggatggcgagaacta tatatatttgtgataaattcaatactattcttgatgtaggtgtattggct tattgtaagagtattttgtaattatcatatcgtttttattttttctccaa atatgtatatattgcttggatgtttcagtaccctcagttgcgatccaaat tgaagaaatcttggcctgacgtggaaagtgggaatgatacaaaattttgg gaaggcgaatggaacaaacatggtacatgttccgaagagaaactaaacca aatgcaatacttcgagcgatcccacaacatgtggaggtcgtacaatatta cagaggtccttaaaaa
back to top

Coding sequence (CDS) from alignment at AB093131:1..1266+

>AB093131.1-Sg-RNase.m1 ID=AB093131.1-Sg-RNase.m1|Name=Sg-RNase|organism=Prunus salicina|type=CDS|length=239bp|location=Sequence derived from alignment at AB093131:1..1266+ (Prunus salicina)
back to top