SNP_FB_0767496, SNP_FB_0767496 (genetic_marker) Malus x domestica

Marker Overview
NameSNP_FB_0767496
AliasF_0767496_L8_PA
dbSNP ID.
SNP Array ID
480K SNP array for apple:AX-115198474
20K SNP array for apple:SNP_FB_0767496
TypeSNP
SNP AllelesT/C
Probe 1SNP_FB_0767496.probe: CAATTTTCACAAGCTTGGTGTCATAATGACTCCCAACTATTGTAACTTTG
5' Flanking SequenceAGATCTGAGTACAAAATAAGATTGCAAACATAGGCTGTGNATGGCATTCCTTAGAGTTAG
3' Flanking SequenceCAAAGTTACAATAGTTGGGAGTCATTATGACACCAAGCTTGTGAAAATTGTTGAAGTCAT
SpeciesMalus x domestica
Primer 1SNP_FB_0767496.S8_496_For: CCTTGCCGTGTGAAAACCAT
Primer 2SNP_FB_0767496.S8_496_Rev: GGTCTGGAAGAAACCCGACA
Primer 3SNP_FB_0767496.S8_496_TSP: ACGCATTCCTTAGAGTTAGG
Publication[view all]
ContactMichela Troggio
CommentTSP (Temperature Switch PCR) primers
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
S8_496_ForSNP_FB_0767496.S8_496_ForMalus x domesticaprimer
S8_496_RevSNP_FB_0767496.S8_496_RevMalus x domesticaprimer
S8_496_TSPSNP_FB_0767496.S8_496_TSPMalus x domesticaprimer


The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeSNP_FB_0767496.probeMalus x domesticaprobe


Sequence
>SNP_FB_0767496 ID=SNP_FB_0767496|Name=SNP_FB_0767496|organism=Malus x domestica|type=genetic_marker|length=60bp
ATGGCATTCCTTAGAGTTAG[A/G]CAAAGTTACAATAGTTGGGAGTCAT
TATGACACCA
Alignments
Feature NameTypeLocationAnalysis
Chr08 chromosome Chr08:30431629..30431629- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation