CBV_ANAC072, CBV_ANAC072 (genetic_marker) Prunus persica

Marker Overview
NameCBV_ANAC072
Genbank IDN/A
TypeIndel
SpeciesPrunus persica
Primer 1CBV_ANAC072.CBV_ANAC072F: ATGGGTGTGCCAGAAACCGACCCA
Primer 2CBV_ANAC072.CBV_ANAC072R: CCGAGCTTGCTGTCCTCCTGCT
Publication[view all]
ContactClaudio Meneses
Contact
NameDetails
Claudio Meneses
First name:Claudio
Last name:Meneses
Institution:Uninversidad Andrés Bello
Address:República 217, Santiago, Chile
Country:Chile
Email:claudio.meneses@unab.cl
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CBV_ANAC072FCBV_ANAC072.CBV_ANAC072FPrunus persicaprimer
CBV_ANAC072RCBV_ANAC072.CBV_ANAC072RPrunus persicaprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
ripening timeqRPT.VV-Ch4-2012Prunus persicaQTL
ripening timeqRPT.VV-Ch4-2013Prunus persicaQTL
ripening timeqRPT.VV-Ch4-2014Prunus persicaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CBV_ANAC072CBV_ANAC072Prunus persicamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-VV-F2G4N/A36.5CBV_ANAC072View