CBV_ERF4, CBV_ERF4 (genetic_marker) Prunus persica

Marker Overview
NameCBV_ERF4
Genbank IDN/A
TypeIndel
SpeciesPrunus persica
Primer 1CBV_ERF4.CBV_ERF4F: GCCACATTAGGCTAACATTGTGC
Primer 2CBV_ERF4.CBV_ERF4R: TTTGGAGTTTGGGCTCGGGATT
Publication[view all]
ContactClaudio Meneses
Contact
NameDetails
Claudio Meneses
First name:Claudio
Last name:Meneses
Institution:Uninversidad Andrés Bello
Address:República 217, Santiago, Chile
Country:Chile
Email:claudio.meneses@unab.cl
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CBV_ERF4FCBV_ERF4.CBV_ERF4FPrunus persicaprimer
CBV_ERF4RCBV_ERF4.CBV_ERF4RPrunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CBV_ERF4CBV_ERF4Prunus persicamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-VV-F2G4N/A33.6CBV_ERF4View