TP2819, TP2819 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP2819
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP2819TP2819-1.94Fragaria iinumaemarker_locus
TP2819TP2819Fragaria iinumaemarker_locus


Sequence
>TP2819 ID=TP2819|Name=TP2819|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCAACCTCCCGTTTTCTTATTTTCTTTTGTTAGTGAACATTAAAAT
ATCCGAGATCGGAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A1.94TP2819-1.94View
2Fragaria-Fii1N/A1.94TP2819View