TP3561, TP3561 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP3561
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP3561TP3561-2.423Fragaria iinumaemarker_locus
TP3561TP3561Fragaria iinumaemarker_locus


Sequence
>TP3561 ID=TP3561|Name=TP3561|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCATAGTTTGTGAGACCAAACTCAAGCCCATAGTGTGGCAGCTCAT
GAGCATAGGCAGAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A2.42TP3561-2.423View
2Fragaria-Fii1N/A2.42TP3561View