27_261428, 27_261428 (genetic_marker) Fragaria iinumae

Marker Overview
Name27_261428
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
27_26142827_261428-2.423Fragaria iinumaemarker_locus
27_26142827_261428Fragaria iinumaemarker_locus


Sequence
>27_261428 ID=27_261428|Name=27_261428|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TCTGGGCAACAATATCTTTGTTTGTAAATCTCACAACAAACCGGTACTTG
GGTGTGTTGTATTT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A2.4227_261428-2.423View
2Fragaria-Fii1N/A2.4227_261428View