TP2303, TP2303 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP2303
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP2303TP2303-4.369Fragaria iinumaemarker_locus
TP2303TP2303Fragaria iinumaemarker_locus


Sequence
>TP2303 ID=TP2303|Name=TP2303|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGATGAGTTTGGGACGTTGGTATGAAAGTAAACTATACCTTTCCTGA
ACACGGGTTCTTGC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A4.37TP2303-4.369View
2Fragaria-Fii1N/A4.37TP2303View