27_459772, 27_459772 (genetic_marker) Fragaria iinumae

Marker Overview
Name27_459772
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
27_45977227_459772-4.369Fragaria iinumaemarker_locus
27_45977227_459772Fragaria iinumaemarker_locus


Sequence
>27_459772 ID=27_459772|Name=27_459772|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAAAATGTGGTCCATTACATGATTACATCRCTAACTGCCGGCAGCGCT
TAGGCGGTGAGGCC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A4.3727_459772-4.369View
2Fragaria-Fii1N/A4.3727_459772View