27_769359, 27_769359 (genetic_marker) Fragaria iinumae

Marker Overview
Name27_769359
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
27_76935927_769359-7.78Fragaria iinumaemarker_locus
27_76935927_769359Fragaria iinumaemarker_locus


Sequence
>27_769359 ID=27_769359|Name=27_769359|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TTCCTAAACTTTTCTTGCCGGATATCAGAAAYATGAGTATATCTCAGAAT
TTACGAAGGTTAAC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A7.7827_769359-7.78View
2Fragaria-Fii1N/A7.7827_769359View