TP6704, TP6704 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP6704
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP6704TP6704-11.687Fragaria iinumaemarker_locus
TP6704TP6704Fragaria iinumaemarker_locus


Sequence
>TP6704 ID=TP6704|Name=TP6704|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGGCTCTCCATTTTGACAGTTGTGATGGTCTTCGGTTGAGTAATATT
ACGCATATTAATAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A11.69TP6704-11.687View
2Fragaria-Fii1N/A11.69TP6704View