54_230708, 54_230708 (genetic_marker) Fragaria iinumae

Marker Overview
Name54_230708
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
54_23070854_230708-13.151Fragaria iinumaemarker_locus
54_23070854_230708Fragaria iinumaemarker_locus


Sequence
>54_230708 ID=54_230708|Name=54_230708|organism=Fragaria iinumae|type=genetic_marker|length=64bp
GACTCCCGAAAAGCTGCGCCTTCAAAGCCTCRAAAGCCGAGTCCAGCCTC
TCCAGCATATCCAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A13.1554_230708-13.151View
2Fragaria-Fii1N/A13.1554_230708View