54_230769, 54_230769 (genetic_marker) Fragaria iinumae

Marker Overview
Name54_230769
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
54_23076954_230769-13.151Fragaria iinumaemarker_locus
54_23076954_230769Fragaria iinumaemarker_locus


Sequence
>54_230769 ID=54_230769|Name=54_230769|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CCAGCGCATTCTTATTATACACAAACAAACCGTAATACAAATCAAAGCTG
TCCCCTGCAGTATT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A13.1554_230769-13.151View
2Fragaria-Fii1N/A13.1554_230769View