54_537633, 54_537633 (genetic_marker) Fragaria iinumae

Marker Overview
Name54_537633
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
54_53763354_537633-20.483Fragaria iinumaemarker_locus
54_53763354_537633Fragaria iinumaemarker_locus


Sequence
>54_537633 ID=54_537633|Name=54_537633|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGGAGACATGTGTACACAAAATTCTGATGACAATGAATCCTTGGATATCG
TTATTTGGATTTGG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A20.4854_537633-20.483View
2Fragaria-Fii1N/A20.4854_537633View