54_571711, 54_571711 (genetic_marker) Fragaria iinumae

Marker Overview
Name54_571711
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
54_57171154_571711-20.483Fragaria iinumaemarker_locus
54_57171154_571711Fragaria iinumaemarker_locus


Sequence
>54_571711 ID=54_571711|Name=54_571711|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CGGCAACTTGTCCCATTTATCGACACCGGAAYGGAGTCGGTAAAGCGTAG
GCCCGACCGAGTAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A20.4854_571711-20.483View
2Fragaria-Fii1N/A20.4854_571711View