54_738214, 54_738214 (genetic_marker) Fragaria iinumae

Marker Overview
Name54_738214
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
54_73821454_738214-21.246Fragaria iinumaemarker_locus
54_73821454_738214Fragaria iinumaemarker_locus


Sequence
>54_738214 ID=54_738214|Name=54_738214|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CATGAAGAACTCCATGCAGCAGCACAGTTTGMGCCATGATCGCTCAATTC
AAGTCTCAATCTTT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A21.2554_738214-21.246View
2Fragaria-Fii1N/A21.2554_738214View