54_805565, 54_805565 (genetic_marker) Fragaria iinumae

Marker Overview
Name54_805565
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
54_80556554_805565-22.419Fragaria iinumaemarker_locus
54_80556554_805565Fragaria iinumaemarker_locus


Sequence
>54_805565 ID=54_805565|Name=54_805565|organism=Fragaria iinumae|type=genetic_marker|length=64bp
AGAGAGCCAGCCGGGATTTGAAACTTTCCGATGGACCTTTCCATGGTAGA
TGCTTGTTCTACTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A22.4254_805565-22.419View
2Fragaria-Fii1N/A22.4254_805565View